Tupaia_belangeri Locus Mono:120:SNORD83
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:120:SNORD83
Tupaia_belangeri
Mono:120:SNORD83
scaffold_118291
SNORD83
1001..1077
1595
TTGCTATAGGGAGTGTGTGCTCCCCAGAAACAGAGACAGAGAAAGTGAGAAATCACCTC
ACGGGGGCGATAGCCGTGCCACGATCCACCCTTCTCCATTCTTCTCTCAGGATCTTGGGC
ATGTATGCACATGTGCCTGGTAATGAATTTCAAGCCACTGGGTCTCAGACTCAAACCACA
GTCTGCTACATGAGTCCAGTGCCTTCAGCACTGTGCCACCTGCCGACCCCCACGTCTAGT
GTGTTTTTGAAGCTTCCAGGGCTGTGACAAACTCAGTCTGCTACATGGGATCCATCTCCT
TTAACTACTAGCAGTCCCCAGCTTTCTTGGCACCAGGGACTGGCCTCATGGGAGAGAATT
GCTCCATGGACCACGGGTGGCAGGCCTGGTCCTGGGATGGCCCAAGTGTCCCATATGCAC
CATACACCCCATTCCCACCACTACCACATTGCAGTGTATGGTGAAGCCATTACCAGTCGG
GCTTGTGCTCCCATGAGAATCCAGTTCTACTGCCTTTGAGCCAAATGATGTTTATTTGGT
ACAGGAGCACTTCTGTGCAAGGACGACTCCTCATCTATCACCCATGACTGATGGCTCTGG
GCTCCCTGGTTGTTACAACACTGCTTGATTTTTTTTTTTCCTTTTCTTTAATAAGTTGGG
GGGAGGGAAAAATACCCTCAACAGGGTCTCATGCCATGATTTCCACCCTGCCTGGCCTCT
GGGATTATGGGTACAGTTGCCTCGTGTGTACCGGGCGACTGGGGAACCAAACCTGTCGTC
TCCCTGTGGACCCAGCTTTACTTGAGCAGCGCATTACCACTCTGTCACCCAGCTGTCCTT
CTGCTGTGTTTTTCAGTGACCTTGGTGATGGGGGTGTTGTTTTTCTTTTCTATGATAGGT
GTTCCTTTATATTTGAGAGTGGGAGACTGATAATCTTAGACACAAGTTGTCACCACCACC
CTTCTCTCGATAGACTGCTGTCCTGGTGTCGTAGAGGAGAGGTCAGCCTGAGGAGAGTCT
TCTCTCCTCACATGCCCAGCACAGCATGTGTGATCGCGTTCTAAAGCTGGAAAGCTTTCA
GAGCTTGAGTTCCAGAATTAATGTGGAGAATCTGGAAAATTTTTATAGTGCAGTATTCTA
GTGTGCTAAGTGGGGATAATAAAAGATTGTAAGAACGGAATTTTGGTGTTTAGGAGAGGG
GGGATGGGACATAGGCCCAGAGAGGTCATTCCAAGTGATCACCATAAATGGCATTGTGCT
AAGGAAGGCTCAGGGTCGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved