Tupaia_belangeri Locus Mono:88:SNORA70
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:88:SNORA70
Tupaia_belangeri
Mono:88:SNORA70
scaffold_118440
SNORA70
1001..1144
2144
AAGCAAGCTGCTGGGTCTGGGACTTGAACCACAGTCGGCCATATGAGAGTCCAGTGTCT
TAATCACCACACTACCTGCTGGCCCCTGTGTGTAATGCTCTTGGGAGAGAGCCCGGGCTG
AGTACAACGACACACTGCTGGGTGTGGAGAAAGCATACCAAGCCAGGGATGGAGCTGACC
TGCTGCCGTCCCTTTAAATCGCGGTCTCGCACCCTCTACTCCCAGCCTTCCAGGGAGGAC
GGTCCTCAGTGAAATCCGCTTTCTCAGGAGGGGATGCGTGCCCTGTCCCTAGGGTGGGGG
GCTTTGGCTGGAGGGGACTGTCAGGCTGATGACCTGAGAGCCTGTTCTGCCTCTTCCAGC
TCAAGATTAGTTTTGCTTTTTTATACTGAGGACAGGCGGAGAGCTGCGGGTCACTGGCCC
GCCTCGCCTCGCACAGGGAGCTGGCTCCCGTCAGCTGGTCACCATGGAGTTTCTTTTTTT
AGCGCGTAAACAGTCGAGCTTTCCACGGCTGTTGCTTCGTCCAGGGCGGGAAGCAGCCTG
TCTTGGGCTGGGCTGGTATTTCTAGGGCAAACAGATGCCGTGTCTCAACTCCCCCGTTAG
GAAGTCCAGCAAATGTGGCTTAGCGATGGCAGGTCCAGCCAGATCTGGTTACTCAGACGG
CTTCACCTGGGAGTCCTCTCTGAATGTCCAAGCCACAGATAGAGGACGTATATAGAAGCT
AGAGTGCTCCACTCCTCCGCGGCCACCCCCGGAGGTGGTGAACACAAAGTGCCAAGTCAG
AGAGGAAACTCTGTTTTGAAGCCAAAGCATAAAAATCCCCAGCCACAAACCATGGAGTTT
TGACTGAGCTTGTTTTGTGCAGGTTCTAAGCCCAGGGAGGGCTTCCAAGGGGCGGGAGGC
TGGCTCTGGGGACGGGTGTGTAGGAAGGCTGAGAGGGTAAGGGCCCTCCTGCAGGCGAGA
GAGCACGCGCAAGGGCATAGAGGTGGGGATGTAATGTCTGTCTGCAGCCCATTCAGCCCA
CCGAGCCCCTCCCCTCGTGGGGGTCCTCCGGTCAGTGGTTCAGTGGTGGCAAACAGCAGC
CTTCTGGGTAGTGAGCCTAGCCCGGACCTTGTGTGCCTTTCCCCAAGGTTACCCTGGAGA
CTGCCCTTTGCAATGCGTGCTCGTGTCTCTGGCCTCGTGCTGTCCTATGCGGTGCCTGTG
AAAGCCCCAGGGCCCGGTGGCCGGGGTCCACGCTGGCCAGGTCATCACGTGTATGCACAC
AAGCTGAACAAGGGGCATGTGACTGAGGCCCTGCACAGGGCCAAGTTCAAGTTCCTTGGC
CACCGGAAGATCCACATCTCGAAGATGTGGTGCTTTACCAAGTTTAATGTGGGTGAATTT
GAAGACATGGTGGCTGGGGGTCAAATACATCCCCAGTCACGGCTCCTGGACAAACAGTGG
GCCCCACATTCATGCGGGCTGCCCTCTCCCTAGTGCTCACCAGTGTGTCCTACTCACCAT
CCAAAGAGGGGGGAGAAGCGTATCAGTATGCTGAGAAAGAGTTCGGTTGGGACAGAATAG
AAAAATTTACAGAGTAGAAAAATTCAGCGCATATTATCTGAGCGTCTACGAGGTGCTAGA
CGCCCTTCTAGTCACTGCAGTAGAGTTGGTGAGCAAATCTCTGGACATTTCAGTGAATCA
AAGTAACAATGTAATAATAATAGCTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTGAAGGGGACAGGTGATGGGAGGGCGTGG
AGCCTCACGTGCCGGCGGGGAGAGGAGCAAGACCGAGAAGAACCCACAGACAGGGCTGAG
AACATTCCTCCGGCCAGTGCTTGCCTAGATAGATTGGTGAACTAGGCACAAACCGATCAT
TCCCTGGCCAGAGGACTGACTACCAGGCTCGTAGTTTCTTATGCTTTTTATTGTGATTAA
TTGCAGCTCGTGGGGGGTGAGCAGGCCTTTCTGGGGGCTCCCAGACTTGTGGAGGATGTG
TCGATATCACAATATCCAAGCTTGGGCCTTCTCCCCCAGTTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved