Tupaia_belangeri Locus Mono:144:SNORA51
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:144:SNORA51
Tupaia_belangeri
Mono:144:SNORA51
GeneScaffold_5185
SNORA51
1001..1122
2122
TGTTTTGCTTTGTAATTAATTTCTTGGCATTCTTAAATCATTACGATTCGAGTCTCTAT
TAAATCTATAAGAAACAGCAGTGGGGAAACATTAAATATCCATGTCTCCACAGCCTCTTT
TTATAGCATAGTGCAGCCCATTTAATTAATTTTTCTCTTTCCTCATAAATTAGTTCTTCC
TATGCCGTAATCAATCTTCTAGCCCATCTCTGAACACGCTCCAGTTTATCTTCATCTTTC
TAACAAACAGTGTCACTAACTGGGTGAGAGGTACACAGTCTCAACTATGCTCTGCTTTTA
AGGAAATCTCTAACAAGTCAAACTGGCAACAGAAGTGGCCACTGCAACGCACTGCTGATT
AATGTTTACTTTCTGTCTACTATAACCCATGTCACATGCATCATGATGTGCTGCGTGTTC
AATTACCCCAAATACTAATATTATGGAAAATGTTGGCATATACATAGTTTGCATTTCTGA
GATAATTTTTATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATAA
TTTCTATACCTTTATCCATTTAGTATTTCAGACTGATGTTTGGGGTTCTTCTTTGTATTA
AATTCAAAGGTCTCTGTAATTTGTCAATGACCTATTCTGGCCATCAACTTCAAAACTAAC
AGGCCAAAAAATTACTAAGATTTCTGTTCAACATTGCACAGTTTTGGAATCAGGTAGGCA
GAAAGGAGAGGGTCGGGAGTTTTACATCTGTAACAAGCTCTTTTGTGATGCATATGCCGC
TGGTCCATGGACCCACATTTTGAGTAGGAAAGATTTCAGACAGATTTTAATTCTTGAAAT
AGTATCCTACCATGCTGTCTGAATTTACACTAGGAAGAGTAGGTCGATTCCTTATTATAG
TAAATTAAGTGTATTGTTTCAAATTTAAGAAAGTATAAACTAGCCTCCTGGTGCTTATCA
CAGGCTGTGTTCCTAGAAAGGGGAGGCAGAGTAAACCTGCCCCAATTACACCTTAGCCCA
GGCTCTCTTGTGCCTAGTCCCAATTGTAAATGGAAGGACGTGGAGAAAGAAAAAAAAAAC
AAAAAACCAAAAACCAAAAAACAAAACTATATAAATAAGGAAGCCTAAGGAATGTTTTAG
TTCTGGGTATAGAACACTTATCTTAACATTATCTTAATTATGGGTAAGATAGCAGAATCT
GTAAGTCAATGGCTGATTCCAATAATACAAAATAAGTTACGAACACTACACTTTTGCAAT
AATAACTATATATAAAAGTGTTATTGTACTGGTTTTACTTTCATAAATACGTAAAGGAGC
AAAATCACTAAAACCACGGAAAACTCTTGTATCCAAATAATGAAAAAAAAAAAAAAATCA
GGCTAACAGACAACTTAAAAATCACTTTTACACTGTGAACCTCACCAGAACTCTTTACCA
CCATGCTAGGATTAGGGACAAGATGGTGGAGGAGCTCCTGGAGACATTCAGGGGCACAGA
GACTAAGCAGAGCACTGATTTGTCACTGGGCATCATGGAACCAAAGACCACAATTAGCTT
TGCACTGTATGCACTTTGTTGCTTAGGCTTGAGAAAGGTTATTCCCGGAATTGGTGGCTT
TTAAAATTATGGCACTATATTAAGAAATCATAACTCAGGGATAGCTGAAATCCTATTTTA
TTTTTTCTGGCATACTGATAACTTAATCACTCTAAAGCTAGCACTGAATGGGGAGGAAAA
TGCAGCATATAACCAAGGTCTTATCACCCACCTTCTTGGTGGCCAAGCCAGCAAGAATGG
AAAAGAAATGAGTGACTCAGCTTGGAACAGCAAAATAGAGAGTGCTTAGGAAACATGGCC
ATTAGGCCGTGTTTCCTAAAGCATCTGAAACACAGTGGGCCCTCATTTCTACGAATAGAA
GATCTTTCAAGCACCCTGCCTGACACTGTTCATCTGACACTAATGGACAATTGTCCCTTC
CTAAAAGCAGCCATAGCTATAGCTTAATCCAACTTCAACCCATCTCATTCTCAGATGATT
GGTAAAAGCAGTCCCTGGCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved