Tupaia_belangeri Locus Mono:181:SNORA64
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:181:SNORA64
Tupaia_belangeri
Mono:181:SNORA64
GeneScaffold_2797
SNORA64
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACAGTCACACTTGGTTT
CACCCGTGTGGCTTTCGTAAAGGGGATTAGAGAGCAAAGATCCCCTCGGGACCCAGGAGT
GGCCTCATGTGGCTTCTCTTCCCTCGAGGGGTGCAACAGGCCTGGGGGCGGGAACTGGGG
GTTGTGGGTACTGATGGTGTGTACTGCCCACCTCACAGGGTCTCTTCACAGGCATTTGTC
GCCATCGGGGACTACAATGGCCATGTTGGTTTGGGCGTGAAGTGCTCCAAGGAGGTGGCC
ACTGCCATCCGAGGGGCCATCATCCTGGCCAAACTCTCCATTGTCCCAGTGCGGAGAGGC
TACTGGGGGAACAAGATCGGCAAGCCCCACACTGTCCCTTGCAAGGTGACCGGCCGCTGT
GGCTCTGTGTTGGTGCGCCTCATTCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCT
GTGCCCAAGAAGCTGCTGATGATGGCTGGCATCGATGACTGCTACACCTCAGCCCGGGGC
TGCACTGCCACCCTGGGCAACTTCGGTAGGTGACCCACCTGCGGGCAGAGGCCTCTCAGC
CCCGCGTGCTCGGTGTTTTCAGGGCAAAGGCCCTCCTAGTACACGGCTGGCCTGCCCGAA
GTGGCCTCTGTTCCTAGGAGGCAGCTACTGCTGGGTTGGCCGGTGCCCTCTCACCTGCCG
CCAACCCTCCCGGTCTGTCTCCTGTCTCGCAGCCAAGGCCACCTTTGATGCCATCTCCAA
GACCTACAGTTATCTGACCCCTGACCTCTGGAAAGAGACCGTGTTCACCAAGTCTCCCTA
TCAGGTACTGGCTGCTGGCAGCTTTTTGGCCCCCGTCTGGGCCGAAGTGGGTGGTTGGTT
ACACCTGAGGCTGGTTTGTCTTCTAGGAATTCACCGACCATCTCGTCAAGACCCACACCA
GAGTCTCTGTGCAGAGGACCCAGGCTCCAGCTGTGGCCACAACCTAGGGTTTTTCATGCA
GCGAGAATAAAGTGAATTAAGCCTGAGAACTTGTCTTTGTGCTGTGTTTGGTGTAATGAG
GGGAGGCAGGACACCGATGTAGGAGCAACAGGCGTTTTATTGTGGGAATGGGGTCACAAG
GGCTGACACCCAGCCTCAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved