Tupaia_belangeri Locus Poly:5:SNORA73
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:5:SNORA73
Tupaia_belangeri
Poly:5:SNORA73
scaffold_71129
SNORA73, SNORA73
1001..1204, 1866..2069
3069
CGCGAGCACGCGGTGCTGGCGAGTTCTTCACGCCGCTGGGTCGGGATGGAAACCTCATT
TAGCTCTGTGAGATCTGGCCACCAGACCCGCGCAGCCACCACGCCACTCGCTGGCCCTGT
AGCTCTCTTTTCCGTTTGTTATTATTTTCTAAGAATTACTTATTTAACTTTATTTGTTCA
TTTTTTTTTAATATTTTTAATTTGACCAGAGAGACAGGGAGAAAGAGAAAGAAAGTGAGA
AAGCAAGCCTCCAGGTTCGGGACTCGAGCCGTAGCCCAACACGGGGGAGTGCCCAACGCC
TTAGCCACCACGACGCATGCCTGCTGGTCCCCGTAGGTCTTTATTTCCGCCATACTGTCC
CGTAGGACTGTACCAAACAGACCATGACCGGCCCAGCTCCGCACCTGCGAGCCGGTCTCC
TAATTCCGCTCCCGGCAACGTCCCGCGCAAACCGCTAGTATCGCGAGAGTCCGCCCATGT
ACATAGGGGTGGGGTTATGCCGCCAGTAGATTCCCAGGAGCCTCAGTGAATTTCTGACCC
CTTAGTGCGCCTGTGCCTGCGCAGGCGCAATAGCTAGGTTTTGACTTCCGGGCTCGTAGG
GTATAAAAACGGATGCTTCGGCAGCACCAAGCCTTTCGGACGGAGTCTCGCCCTGTGTCT
CCTCGCTGGTGGTGAGTCTGTTTCGTTTTACTCTTGCGTGCATATTACTTCGGTTCGCCC
GACGTTCTTTACTCTAAGGACCGTGTTCATTACGAGCGTTTTCTCCGATGGCGCGCCCTG
CAGCTTCCCGTGTGCGCGTAGGCCCGGGCTGGTTGGAGGCCGCGAGACTTCTGCAAGGAC
AGCACCGGCGGCAGCCGCGCCGAATCCGCAGTGCACGCTCTGCAGTTTTGTGCGCCTACT
GTCCGCCTTTTCCTGGCCCGCTCCTGGGCTCACGCTAGCGGGGTTGCACGCAGTATGTCT
CGGTACACTAGTGTGTTCGCTTAACGGGTTGTGGAGACTGTCCAACGCGGATACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCTGGTGGCATAGGGGAGCATAGGGCTCTGTCCCGGG
ATGTACAGTCCCTTCCCACGGCGTTGGAGATGAAGCTGGGCTCCGCGCCCGCACCTGCAT
ATTCCTACAGCTTCCCAGAGTCCTATGGACAGTGACTGGGGGGACAAACCATGCAGGAAA
CACCTCTAGAATGCAGAGATAACTCCCGATTTATGTTTTATACAGAAGTTAACTATAGAT
AAAATAACTTCTCTTTTGCAGAATCTGCTCAGGATTGCAAATACTTTGAGGTAAGTTTTT
TGAATTTGTTTGTGGCCTACCAGTCTGTAGGCATTTTCTGCAGCGAAGCCTGGCTTCTAA
ATGAGCTAGGGTATTTGATCATCCTGAACTCCCCTTGAACATTGACGGTGTGGTCGTATG
CTCACATTCTGTGAGAATTGCTTTTGCACAATTAAGTAAAACTGCGCTCACCGGTTTAAA
CCTTAGTGTGGTTAAGATTTCTACAAGTTGAGATCGGGAGGTTTGGCGGTGACCTGACGC
TGTGGGGAGTTTGTCCGTGAACAGGTGCACATCCACCGCAAACACAGTTCATGAGCGTTA
AACACGCCGTTTACTCTGTTGTCCCTTGCCACTGTTGTAGAAGCTGTGTACGTGTACCTA
AAAGTGAAAAGAGTGCATAACCAGTGACTGCGTGGGGAAACTGAAATAGCAAGACATCTT
GTTTTTCAAAGCACTTGCTGGCCTTCCCGGCCCTGTTAGGCTTTCTCTGAGAGGTGCAGC
TGGGATTAGACTTTGGAAATGTTTTTAAGGGATGATACTTTGCCAGGCTTCTGTTCATCA
GTTATTCCAACGCGGATACCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATA
GGGGAGCATAGGGCTCTGCCCCGGGATGTACAGTCCCTTCCCACGGCGTTGGAGATGAAG
CTGGGCTCCGCGCCCGCACCTGCATATTCCTACAGCTTCCCAGAGTCCTATGGACAGTGA
CTGGGGGGACAAACCATGCAGGAAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved