Tupaia_belangeri Locus Mono:82:SNORA71
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:82:SNORA71
Tupaia_belangeri
Mono:82:SNORA71
scaffold_97910
SNORA71
1001..1132
1231
AAATAAATAAAACAAAATAGAGCTGGGTGAGGTGAAGTTCTGCCTGTAGTTCCCACAGG
GCAGCCAAGGCAGGAGACCCTGTCACAAAACTAAATTATCCCCTGCATTTGTCAGTGGTC
ACGGGCTGCCCGTGTCCTGGTCAGCGGAAGTGCAGGCAGAGGAGACGGAAAAAGGTGGCC
AGCGTTTGCAGGTTCCATGTGGTTGCCTTCCAGTTCTGGGAGCTTTGCCACACTCCTGCT
TCTCCACCCTGCATGCACTTTGGGCCTCCAGGGCATTGGGGGCTGCCGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTTATTGTCATTTTTTTGTTTTGTTTTAAGAGT
TTTTTTTTTTGCTATAGGGCGCATGTGCTCGCCAGACAGACAGAGAGAGACAGAGACACA
GAAAGTAAGAAATCACCCCCCAGAGGGGATGGCCACACCGCAATCCCTTCTCCTCCATTC
TCCTCTCGGGATCTTGGGCACGCACGCATACGCGCCCGGCGTGAGTTTAAGCCACCAGGA
ACGCAAACTGCAGTTGACTACGTGGGAGTCCAGCAACGTAGCCATTACGCCAGCTGCTGG
GTCCCGCGTTATTGTCGTTGTGGGCTTTCGCTTCCTGTCCTGCTGTCAGGGTGCAGGCTG
TGTGTGTCCCTTAAGTTTGCCTGGATGAGCAGCAGGGTCACTGCCTGTCAATCCCGGCAC
TCCCCAAACCTGGCTTTGCCGTCCGTCAGCCTGTCACTGGTCACGTGCTCGTAGCGTTGG
CCACCCTGGCACAGACCGTGAGGGTCTTGCTAGTTCAAGTTTACTGCTTTCTTTCTCATC
CGGAAGTAGTGCTCACTCGGAGAACAGCAGCCAGCAGGCCCGGAATGCTGTTCCATATCT
GCTATTCCTTCCCAGAGCCTGCCATGGCCTGCTCTGAGCAGGGGTTAGCTGGGTGCTCCT
TCCTAACTTCTTATCTGCTGAAATAAACAAACTAAATTATTAAAAAGAAGAGGAGGGCTA
GTCCCATAGTGCAGTGGTTCAGCTGTGTGTTGACAGTCAAATCCCATTTGGTCAACCACA
GTTCAAATCTTGGCTCTAACCTGAAAAACACGCAGGTGCTTGGCGAAGGCTGCTGCATCC
CATATGGCTGACCATGTGGTTCAAGTCCCTGGCCCGGTCCCTTGAAAATCACACTAGTAT
GTTTGTGAGTGCCCAAAATCCCGAGAGGAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved