Tupaia_belangeri Locus Poly:1:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:1:SNORD116
Tupaia_belangeri
Poly:1:SNORD116
scaffold_9992
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1078, 2509..2588, 4354..4433, 6200..6279, 8045..8124
9124
GTGCCTGTCTCCCTCTGGGGTTGTATTGGCATACCTGCTGCCTTTCAGAGAAACTTGTA
ATGTCCAGTAGTATAACAGATGAAGGCAATTCTGGAGGCATGTTCGTGTTATCCTTTAGC
ATCTAGTGTGATTTTCAACCATGACGTAGACCTCCCTCTGGCATCGAACATTATTCATCT
CACCAGTCCGTTTATTTCGTTTTCTTTGAAGAATAATTGCGGCAACTGTATGAACATATT
GCATCACGACTCAATGGGTCTGCCATTAGCTCTTATCACCTGGCTCTTCTTAGTTATGAA
GTTTGGGTTCCATCTTTCCCGAAGTGAGTTCAAATCGTCCTTGACTTTATCTCCTTGGGA
TCCTCTAGTGATCAAAAAATGTGGTCCTTTTGGCTTTCAAATGCGATTTTACCAGAAGGT
AAGGGCACGCTGACACAAAAGTGTTCGGACAGAATGCTATCAATACAGCTGATTACAGTC
CTCCCCTTTATTTCGTGGTGGCATGGACCTCTTACACTGCTTGGGAGTTCTATTGTCTAA
GTTTGAGTTGAGCCTTGAGCCTTTAACCCTCTCAACCACCCTGTGTGGTCATATTTCTTG
GCGTGTCCTGGCATGCGCATGTGGGGTAAAATGCCTGTCTCCTTTTCGGGTCTTATTGTC
ATAACTGCTTTCAAAGGAAATTGACCATCGTAAGTGTGCTTTGAGGACAAGAAGATTGCT
TCTCTCATGTCATTCCCTAACAGAAGAGACCTAGGAGAATGTCAACTGCCAATCCTGAAA
GCCATTGGAAAGGTCCACAAGGTTAGCATCTTATTCATGGATGAGTCACATAGGTTTGGT
TCTTCTGTGACACCCCATTCCCAGGTAGACTCAGACAGCACTATGTGTTGCATTCATTGG
GAGTCTGTAGTGTTTGTAATTCCATTCCAGGTGACCGAAGATATGAGGGTGTGGTTTTGG
GCCCATCCCTCAGACGCCAGGCCCCTGGTATATTTTTGGCTGGATCGATGATGACTTAAA
AAAAATAAAGAAACCTTGGAAATCTGAACAAAATGAGTGACTACCCTGAGCTGAGGTCCA
GCATGTGAACTCTGGTAGATGCACATATTGAAGGGCATTCTCGGGTCAGCACTTGTATAC
TCAAGGCAATGGGTGTTCAGAGGAATAACACTGGAGCCTGGGTGTGTAGCTGGGAATTAC
TGAGAATTATAGCAATTCCTGGGACAATGTTTCTGTGGCTGGTCAGTTTTCTTCCTGTTT
TCCGACGTCTTTACCTAGAAAAAAAAGTGCTTGAGAAATGAGCATATGAGTAGGATATCC
TGTGGCCTTATTTTATTTCTCCTAGAGACTTGGCCCGTGCCACCTAAATGCTAGAATGCA
TGCCGTTGAGACCATCTGTTTCGTAAAAGTTTGAGATGGCCTTCATGCCCACCAAATAGT
GGGATTTCACTTTGATTGACGAATTGGTGTCTGAAAGATGTTATTTATGGAATGCTGCCC
TCAGTGGAAGCTTAGGGAACCTTCCCATAATTATGAAAGTTCCCTCTGCAGGAAGGGAAC
CTATGATATTTTGTGTAATGAGTATTACCCATCAGACCCAACACATGTTAACCAATGAGA
ATGCTTCACTCCACTCCATGCAGCACCCAATGCACACTCAGATGGAGTAGGTTTCTGTGG
GGCATGTACCTAGATCTCCATTTCACTGTCCCCTCCTCACTATCTACAGAACTATCCATT
TTTTGAGGGAAAGACATTTTTGGGCTGCATCCTTGATTTTGATGATTCTGGTGAACTACC
ATCAGCAGGGCTATATTTCTCAGAGAAACTTGTACTATCCAGTAGTTACGAGTTGGAGGT
GATTGTAGAGAGATTTGCATGTTATCCTTTAGCATCTATTGTGATTTTTTACCATGACAT
TGACTTCTCATGTACATCAACATGCTACACCTAACCAGTAACTTTATTTCATCTTCTTTT
AAGAATGATCGCGGCCACTGTATGGACATACTGCATCACAGCTCAATGGATCTGCCATTT
CTCTTATCACGCAGCTCTTAATCATGCAGGTTGGGTCCCATCTTGCTCAAGGTGAGTTGG
AACTGTCCTTGACTTTTTCTCTTTGGGGTCCTCTATTACCACATAATGCAATCTTTCTGG
TTTTCATTCATGATTATCAAATTGGGAATTTGACAAACTTCACTCGTGATTGTCAGAAGT
TGGGGCACTGTGACACATAGTGTATGGCTCATTTGCTATAAATATGGTTGACTAAAGTCC
ACCCATTAATTTCTTGGTCGTGTGGACCTCTTGCAGTACCTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTTGTCTTTCCATCCCAGGCGACCGGAGGAGAGGGTGC
CGTTTGGGGCTCAGCCCTCACACCTCAGGTCCCCGGTCAATGTGTGGCTGGATCGATGAT
GACTTAAAAAAAAAATAAAGAAACCTTGGAAATCTGAACAAAATGAGTGACTACCCTGAG
CTGAGGTCCAGCACACGAACCCGGGTAGACGCACGTCGTACTGAAGGGGATTCTCAGGTC
GGCAGTTGTAGACTCGAGGCCCCGGGTGATCAGAGCCAAACACCGTGACTTGGGTGTGTG
GCTGGCAATTGCTGAGAGGTTTAGCAATACCTGGGAAACTGTTCTGTGGCTGGCCAGCGT
TCCACCGGTGTTCCCGCCTCCGTCCCTAGATAACGAGGGGCCTGAGAAATGGGCATGTGT
GTGGGGTGCCCAGGGGCCCCATTCCGTGCGCCCTAGAGCCTCAGGCCACGGCATCTAAGT
GCAGAGTGCACGCCGTGGAGGCCATCTCTCCCGCAGAGGAGACCAGATGGCCTCCGGTGC
CCCCAAAGCGTGGGATTTCACTGGTAATGATGAACGGGTGCCCGAAAGATATCGGCATCG
CTGGGATGCTGCCCTCAGCAAACGCGTAGGGAACCTTCCCGTTACTCTGGAAGTTCTCTC
CACGGGCAGAGAACCCGTGAGCATTTGGGGATGAGTAGCTCCCATCGAAGCCAAAACATG
TTAGCCAATGAGACCGCCTCACACTGTGCCGTGGCGAACCCAGTGCTCACTTGGATGGAG
CAGGTCTCTGTGGAACAGTACCGAGAGCTGACCTTGTCTGTCACCGCCGCTTTTTGCTCA
GAATCATCCGTTTTTGGGGGGTTTTTGTTTGTTTGTTAGTTAATCAATTAGTCAATTAAT
TAATTGATTGATTAAGCAATATATTCATTTATTTTTCCGGGGAACGACATTTGAGGCTGC
AGCCATGGGTTTGATCGGTGTGGGGAGTAAGCAGCAGGAGGGCTATGCCATTCAGAGAAA
CCCGTCCTGTCCAGTAGTGTAAGAGATGAAGGCGATTCTGAGGGCGTGTGCACGGTGACA
GTGAGCATGTAGTGTGATTTTTCCACCGTGACGGACACCTCCGTCTTGCCTCGCGCATTG
TCGCCTCACTGCTTTCTTCCTTCTATTTCCTCTAAAGCCTCACCGTGGCCACGGTATGGA
CGCATTGCCTCGCGACTCAGTGGGTGCCGTTGCCCTTATCGCCGGCCGCTTCTTAGTTGT
GAAGGTCGGGTCCCGTCTTGCTCAAGGTGGGTTGGAATGACCCTCGTCTTTTGCTTGGGA
TCCCCCAGTGATGATGCAGTGCAGTCCTCGAGGCTTTCCCTCGTGACTTGACCGGGAGGT
GGGGGCACCTTGACGCCTAGCATTTGGCCCTTGGGCTCCGAATCGGGCTGATTCCAGGCC
GACCCTGTTATTTCCTGTGTCCGGGGACCTCAGGCCGACCTTGGCAGTACTGTCCTCCAG
GGTCGAGTGGAGCCTTGAGCGTTCCGCCCATGAAATCGCCCTGCGTGGTGGTATTTCCTG
GTTCGTCCCCGCACGGGCGGGTTGGGGAACGCGCCGGGCACCTTCCCGGTTTTGTGGACA
TACCTGCTCTCGCAGGAAATGGAGGACAGGGAGCGTGCTTCGAGGACAAGAAGATTGCTT
CTCTCCCGGGGTTGCGCGACGGAAGAGACCTTGGAGGACATCAGCTGCCCGTTCTGCGAG
CCACTGGAAAGGTCCACAAGGTAAGCGTCTCGTTCGGGGTTGACTCGCACCGGGCAGGTT
GGGGTACTCCACGCCCAGGGAGACTTGGATGCCGCAGTGTGTTGCTGCTCCCTAGGAGTC
GTTGGCCTTTGTCTTTCCATCCCAGGCGACCGGAGGAGAGGGTGCCGTTTGGGGCTCAGC
CCTCACACCTCAGGTCCCCGGTCAATGTGTGGCTGGATCGATGATGACTTAAAAAAAAAA
TAAAGAAACCTTGGAAATCTGAACAAAATGAGTGACTACCCTGAGCTGAGGTCCAGCACA
CGAACCCGGGTAGACGCACGTCGTACTGAAGGGGATTCTCAGGTCGGCAGTTGTAGACTC
GAGGCCCCGGGTGATCAGAGCCAAACACCGTGACTTGGGTGTGTGGCTGGCAATTGCTGA
GAGGTTTAGCAATACCTGGGAAACTGTTCTGTGGCTGGCCAGCGTTCCACCGGTGTTCCC
GCCTCCGTCCCTAGATAACGAGGGGCCTGAGAAATGGGCACGTGTGTGGGGTGCCCAGGG
GCCCCATTCCGTGCGCCCTAGAGCCTCAGGCCACGGCATCTAAGTGCAGAGTGCACGCCG
TGGAGGCCATCTCTCCCGCAGAGGAGACCAGATGGCCTCCGGTGCCCCCAAAGCGTGGGA
TTTCACTGGTAATGATGAACGGGTGCCCGAAAGATATCGGCATCGCTGGGATGCTGCCCT
CAGCAAACGCGTAGGGAACCTTCCCGTTACTCTGGAAGTTCTCTCCACGGGCAGAGAACC
CGTGAGCATTTGGGGATGAGTAGCTCCCATCGAAGCCAAAACATGTTAGCCAATGAGACC
GCCTCACACTGTGCCGTGGCGAACCCAGTGCTCACTTGGATGGAGCAGGTCTCTGTGGAA
CAGTACCGAGAGCTGACCTTGTCTGTCACCGCCGCTTTTTGCTCAGAATCATCCGTTTTT
GGGGGGTTTTTGTTTGTTTGTTAGTTAATCAATTAATCAATTAATTAATTGATTGATTAA
GCAATATATTCATTTATTTTTCCGGGGAACGACATTTGAGGCTGCAGCCATGGGTTTGAT
CGGTGTGGGGAGTAAGCAGCAGGAGGGCTATGCCATTCAGAGAAACCCGTCCTGTCCAGT
AGTGTAAGAGATGAAGGCGATTCTGAGGGCGTGTGCACGGTGACAGTGAGCATGTAGTGT
GATTTTTTCCACCGTGACGGACACCTCCGTCTTGCCTCGCGCATTGTCGCCTCACCGCTT
TCTTCCTTCTATTTCCTCTAAAGCCTCACCGTGGCCACGGTATGGACGCATTGCCTCGCG
ACTCAGTGGGTGCCGTTGCCCTTATCGCCGGCCGCTTCTTAGTTGTGAAGGTCGGGTCCC
GTCTTGCTCAAGGTGGGTTGGAATGACCCTCGTCTTTTGCTTGGGATCCCCCAGTGATGA
TGCAGTGCAGTCCTCGAGGCTTTCCCTCGTGACTTGACCGGGAGGTGGGGGCACCTTGAC
GCCTAGCATTTGGCCCTTGGGCTCCGAATCGGGCTGATTCCAGGCCGACCCTGTTATTTC
CTGTGTCCGGGGACCTCAGGCCGACCTTGGCAGTACTGTCCTCCAGGGTCGAGTGGAGCC
TTGAGCGTTCCGCCCATGAAATCGCCCTGCGTGGTGGTATTTCCTGGTTCGTCCCCGCAC
GGGCGGGTTGGGGAACGCGCCGGGCACCTTCCCGGTTTTGTGGACATACCTGCTCTCGCA
GGAAATGGAGGACAGGGAGCGTGCTTCGAGGACAAGAAGATTGCTTCTCTCCCGGGGTTG
CGCGACGGAAGAGACCTTGGAGGACATCAGCTGCCCGTTCTGCGAGCCACTGGAAAGGTC
CACAAGGTAAGCGTCTCGTTCGGGGTTGACTCGCACCGGGCAGGTTGGGGTACTCCACGC
CCAGGGAGACTTGGATGCCGCAGTGTGTTGCTGCTCCCTAGGAGTCGTTGGCCTTTGTCT
TTCCATCCCAGGCGACCGGAGGAGAGGGTGCCGTTTGGGGCTCAGCCCTCACACCTCAGG
TCCCCGGTCAATGTGTGGCTGGATCGATGATGACTTAAAAAAAAAATAAAGAAACCTTGG
AAATCTGAACAAAATGAGTGACTACCCTGAGCTGAGGTCCAGCACACGAACCCGGGTAGA
CGCACGTCGTACTGAAGGGGATTCTCAGGTCGGCAGTTGTAGACTCGAGGCCCCGGGTGA
TCAGAGCCAAACACCGTGACTTGGGTGTGTGGCTGGCAATTGCTGAGAGGTTTAGCAATA
CCTGGGAAACTGTTCTGTGGCTGGCCAGCGTTCCACCGGTGTTCCCGCCTCCGTCCCTAG
ATAACGAGGGGCCTGAGAAATGGGCACGTGTGTGGGGTGCCCAGGGGCCCCATTCCGTGC
GCCCTAGAGCCTCAGGCCACGGCATCTAAGTGCAGAGTGCACGCCGTGGAGGCCATCTCT
CCCGCAGAGGAGACCAGATGGCCTCCGGTGCCCCCAAAGCGTGGGATTTCACTGGTAATG
ATGAACGGGTGCCCGAAAGATATCGGCATCGCTGGGATGCTGCCCTCAGCAAACGCGTAG
GGAACCTTCCCGTTACTCTGGAAGTTCTCTCCACGGGCAGAGAACCCGTGAGCATTTGGG
GATGAGTAGCTCCCATCGAAGCCAAAACATGTTAGCCAATGAGACCGCCTCACACTGTGC
CGTGGCGAACCCAGTGCTCACTTGGATGGAGCAGGTCTCTGTGGAACAGTACCGAGAGCT
GACCTTGTCTGTCACCGCCGCTTTTTGCTCAGAATCATCCGTTTTTGGGGGGTTTTTGTT
TGTTTGTTAGTTAATCAATTAATCAATTAATTAATTGATTGATTAAGCAATATATTCATT
TATTTTTCCGGGGAACGACATTTCAGGCTGCAGCCATGGGTTTGATCGGTGTGGGGAGTA
AGCAGCAGGAGGGCTATGCCATTCAGAGAACCCCGTCCTGTCCAGTAGTGTAAGAGATGA
AGGCGATTCTGAGGGCGTGTGCACGGTGACAGTGAGCATGTAGTGTGATTTTTCCACCGT
GACGGACACCTCCGTCTTGCCTCGCGCATTGTCGCCTCACCGCTTTCTTCCTTCTATTTC
CTCTAAAGCCTCACCGTGGCCACGGTATGGACGCATTGCCTCGCGACTCAGTGGGTGCCG
TTGCCCTTATCGCCGGCCGCTTCTTAGTTGTGAAGGTCGGGTCCCGTCTTGCTCAAGGTG
GGTTGGAATGACCCTCGTCTTTTGCTTGGGATCCCCCAGTGATGATGCAGTGCAGTCCTC
GAGGCTTTCCCTCGTGACTTGACCGGGAGGTGGGGGCACCTTGACGCCTAGCATTTGGCC
CTTGGGCTCCGAATCGGGCTGATTCCAGGCCGACCCTGTTATTTCCTGTGTCCGGGGACC
TCAGGCCGACCTTGGCAGTACTGTCCTCCAGGGTCGAGTGGAGCCTTGAGCGTTCCGCCC
ATGAAATCGCCCTGCGTGGTGGTATTTCCTGGTTCGTCCCCGCACGGGCGGGTTGGGGAA
CGCGCCGGGCACCTTCCCGGTTTTGTGGACATACCTGCTCTCGCAGGAAATGGAGGACAG
GGAGCGTGCTTCGAGGACAAGAAGATTGCTTCTCTCCCGGGGTTGCGCGACGGAAGAGAC
CTTGGAGGACATCAGCTGCCCGTTCTGCGAGCCACTGGAAAGGTCCACAAGGTAAGCGTC
TCGTTCGGGGTTGACTCGCACCGGGCAGGTTGGGGTACTCCACGCCCAGGGAGACTTGGA
TGCCGCAGTGTGTTGCTGCTCCCTAGGAGTCGTTGGCCTTTGTCTTTCCATCCCAGGCGA
CCGGAGGAGAGGGTGCCGTTTGGGGCTCAGCCCTCACACCTCAGGTCCCCGGTCAATGTG
TGGCTGGATCGATGATGACTTAAAAAAAAAATAAAGAAACCTTGGAAATCTGAACAAAAT
GAGTGACTACCCTGAGCTGAGGTCCAGCACACGAACCAGGGTAGACGCACGTCGTACTGA
AGGGGGATTCTCAGGTCGGCAGTTGCAGACTCGAGGCCCCGGGTGATCAGAGCCAAACAC
CGTGACTTGGGTGTGTGGCTGGCAATTGCTGAGAGGTATAGCAATACCTGGGAAACTGTT
CTGTGGCTGGCCAGCGTTCCACCGGTGTTCCCGCCTCCGTCCCTAGATAACGAGGGGCCT
GAGAAATGGGCACGTGTGTGGGGTGCCCAGGGGCCCCATTCCGTGCGCCCTAGAGCCTCA
GGCCACGGCATCTAAGTGCAGAGTGCACGCTGTGGAGGCCATCTCTCCCGCAGAGGAGAC
CAGATGGCCTCCGGTGCCCCCAAAGCGTGGGATTTCACTGGTAATGATGAACGGGTGCCC
GAAAGATATCGGCATCGCTGGGATGCTGCCCTCAGCAAACGCGTAGGGAACTTTCTCATT
ATTCTCAACCTTCCCTCTCTGGGATGTGAAGCCCTGAGTTTTGTCAGAATTGTATATTTT
ATTGGACACAGTATATTCTTTCCCATCAGACTGCTTCACTCCACTGCATTTTTAACCATA
GGCCTCCTCAGATGGAGGAGTTCTCTGTGGGGCCTGTACCTAGAGCTCAACTTCACTGCT
TCCCATTCTGTGTTGTTAGAACAAGTTTTTGTGTTTGTGTGTATTATGACTTTTTTGGCT
GTATACGTGGTTTGATTCATTAAGTAATATCCATTAGATGGATTGTTTCTCTTAGAGAAA
GTTGTTTTTTCTTGTGGTGTAATAGAGTAAAGTGATTTGTGGGGGCATGTTCATGATATC
TTTTAGCGTTTATCATGGTTTTTCACCATGATATAGACAATTGTCTTGCATGGGACATAT
TTTTCTCACCAGTTCCTTTACTTTATTCTAGTTTTCTGACTTAGTTGTGGCTAGTGTATG
AAAAGGTTGCATTATAACTCATGGTTTCTTCCTTTGCATGTATCTCCCAGTTCTTTGCAG
TCGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved