Tupaia_belangeri Locus Mono:211:SNORA38
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:211:SNORA38
Tupaia_belangeri
Mono:211:SNORA38
GeneScaffold_193
SNORA38
1001..1131
2131
AATCTGCTGATCTTTTTAAAAAGTTAAAAGAGTAAGCAATAAATCAGCAGGGAGGGACA
GGTCCTTTGCCATCAAAGTGTCTTGAGATGCAGTTTTAAATGACTTTGTAGTGACCTTCC
CTACATAATTTCAAGCTCAAAAGACATTTTCCTCACATATTCCATGGAGCAACTTTCTCA
GAGCAATGTCCTGCTTCTCTTGGGTGGCCATTTCCAACATGAAATGCCTGCCTGGTGACT
CTCCTCTCTCCTGTAAATGGACAGACTTGGGATCTGGATTTGTGATTCTAATTATCTAGA
GCTCAGAGAGCCATCTGGGCCATGAACATGTGTCGTGAGAACATACGGCTCAGCTAACAC
CAGGCCACGGATAGGGAGACAAGCCTGCCTTTGGTGCCATTAAGAGAAAACATTAAGTGT
CATCACCACTATTCCACGGCAAACCTGTTCCAAGTGTAAGAGAAAGGCACCCTGGTGACT
GAAACAGTCATTAAAAAATCAATATAGTGCCAAAATTGAGCGGCTCAAACTGCACAGAGA
ATCAATTGTGTGACCAGGAAAAAGCTGGTAGGAGGATTAAGCCCAAAGAAAGGACTGGAT
GATATTTAGTGTAAGGTGTGTCCTAGGAAGGTCTGCTATTGTTTACCCACCCAGATCATT
CTGAAAGTTTCAAATCGCAATGGCAATAGTTCTTATAGTTGACCTTGGAGTGTATTATTC
AAAGTCACATTGACTTTGAGGTAGAAACAAAGTTCTTATTGGTAAGAACTTCAGTGTAGA
GCAGTGTCTAAGTTTGGAAAGCAAATTCGAGTTTGAATCCTTGCTCTGCTACTTAGAAGA
TGCACATGTTGGTTGAGTAACTAAACCTCTGTTTCCTCATCCATGAAATGGAAATACTCC
CGGCAGCACAGCCTGGTAGCTGACTGAGACCTTGTTCCTTAAAAAATCCAAAACTTCGTT
TTTTTGTTTGTTCGTTTGTTCTGTTTTTAAAGTTCATTGTAGCCTCCTACATAGACGTGT
CTGCAGTTTCCTGCGTTTGAACATGGAAGAAATGGAGGCAAAGAAACGTGGATCTGAAGA
TTCTAGGGCCAGCATTGCTCCCTGTAGGCTCAAGATCAACCTTCCTACATAGACTCCATC
CCCCAAAAAATATGCCATTGCAAACTGAAACACTGTCCTGAAATAAAATCTAAATATGTA
TGTCACTGGCCTTATTCCCATAATCACTCTGATCCCACCCTATTCAATAGAAGAACACGT
GTTGTGCTGTCCAAGGTGGTAGCCACCTGTGAGTTCAGCCCTCAACACTTGAAAGGCCGC
TAGTGAAATCAGAAACTGAATTCTTAACTGTACTGAATTTTAATTAATTTAAATTCAAAT
AGCTTCATGTGATACGTGGCTCCCATATTGAATAGCACACCAAGTCTGAGCTCTGATAAA
GAATAGGGGATTCGGTGGTGCAGACCTAGCAAAGGTGAGGCAATTACCCCCAGACCCCTC
ACATCAGCTACTGAAGGCAGGCTCACCCTGCCTCACAATCACTCTAGGGCGGCAGTTATG
ACAGAAACAGCACCGGATGGTAGCACCCTTCCAGAGCCACGTCCTGTGACCTTGGACAAG
TCTCCTAATTTTTCTGAACCTGCTTTCTCATCTATAAAATGGGGATAATGCCTCAGGGCT
GTTTTCAAGGTGAAATGCCATCACAGACATCACGACAAATGGAGACCTGTAAAATGAGGG
ACAATGGCAGACATCATTTCGTCGTATCCTTAGTTTTGCAGCACTGGCCATGGGTGCACC
TTGCAATATATTGCTGGTTTTCATGGAAAGACAAAAGCACCCTCCAGGATGTGCATGCTT
TTAGGAAATGTTGCTTGCTAGTAGTGGAGATCTATTTGCCTTCATTTCTCTATTCATTCC
TACCCTGGCTCGTGTTGTAACTTGGAGCGGGGCACATTCACAATACCAAATGTCACAATT
TGGGACTCGGCTTTAAAACATGGAGCAGAGGGTAGCACATTCCTAGAGCATACATGAGTA
TCCATTTACGTACGTGGAGTCAAAATTAGATTTGCAAATTGCACAAGAATCGCATGTGCT
TCTGAGCTTTATTGATTCACCCTAGCTGTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved