Tupaia_belangeri Locus Mono:170:SNORA27
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:170:SNORA27
Tupaia_belangeri
Mono:170:SNORA27
GeneScaffold_1365
SNORA27
1001..1127
2127
GCCCCTGCCACCGGCGTGGGCAGAGGGTGACTCATTCCTGAGTCTCAGGCAGTCACTGG
GTGTCCGGACGACGCACACGGCCGACCAAGAGGGAAGCTAGCGTGGGGATTTGTGCCTGG
GTGATAAGAACGCCTGTGACGCAAGTGACACTAGTCCTCAGAGTGGCTCACTAGGGATCC
CGCGTTCCCGAGCTCTGCGCTGGTGACAGCCACATTAGTAACTTTTTCTTTACATTAAGG
TTAAGGTAGTCGTCCTTTTATTTGTTTTGTTTTGGTTTTTTTTACATTTTTTAAGAATTA
TTTTATCATGATTATTTTTTAATTTGAAGAGAGCGAGAGAGAGAAAGTGGGAAAGTAGGT
CACCAGGTCACCAGGTCCAGGACTCTAACCGTGGTCAGCCGTGTGAGAGCCGAGCTCCTT
AACCACCACACAACCTGCCAACCCCATGGCCATCGTTCCTTAATGGAGAGAAGACAGCAC
GGTTAAGAGAGAATTAATCTGCTTCAATAACCTGAAGGTTCTCCCTGTACCTGAGGGACG
GTGGCCTTGGCCTTCAGCGCCCAGTCACCCGCTTCTAACTTCCTCTCATTTCGCGCCTTG
TCCCACTCCCCGCTGGAAAGGGGAAGAGCACTGCTAAGTGCCAAAGCAGAAGGCCCCCCG
CCTCTGAGTCAGGTAGCAGAGTGCAGATCTTCAACGTTCTCGCTTCTCCCTGGAGGCGCA
GGTTCACTGCCAAATCCATTCTACTCTGTGTCACCCGGAAACCATAAACGCTGTCTTTCC
CCATTCCTGCTGTATTTCCCCATTCCTACTGTATTTCCCCATTCCTGCTGTCTTCTGTGG
CCTGAATCTGGGTCAAGTTCAAGTTCCTGATTCCTGAGTCTCAGTGCCCGCTCCCCACAT
ACTTTCTCAAGACTGACGTTGCAAATCCACAGCCCCTGAACTTTGGATAACAAGGTCTTG
TGAAGCCTGGGCCTGAACCCTAAAGATAAGATTTCACTTAGCACCCCCTTTTCTCTTTGC
CAGTTGGACTTATGTCTTTATTGGCCATTCAAATGGGGCAAAGGAAATGTCCTTTTAAAA
CTCAAGCAAACCAGGTGTTTGTCTTGTATCCTGTCAAAGGAAACAAATTGAAATAGAGTT
AGTGAAATTCTTAAGCAATTTTGTTAAGCGGTTTTAGTTTTCATAGCATAAAAAGGGGCA
AGATTCTTGCCAAGAGAATGAATGTGCGTACTGAGCATATGAAACATTCTAAGAGCAGAG
ATAGCGAGAGAGCTTCCTAAAACGTGTGAAGGAAAATGACCAGAAAAAGAAGGAAGCCAA
AGAGAAAGGGACCTGGGTTCCACTAAAGCGCCAGCCTGCTCCACCCAGAGAAGCCACTGT
GTGAGAACCAATGGAAAGGAGCCTGAGCTACTGGAACCTATTCCCTATGTATTCATGGCA
TGATGGGTGTTAAAAATAAACTAATCTGTGGTTTACCAAAAAAAAAAAAAAATCTTGCCT
AGGGGCCAGCAGGGGTATGGTGGCTAAGGACGCTGGACTTCCACATGGCTGACCGCGGTC
TGAGTCCTGGACCTGGCGGCTTGCTTTCTCACTTTCCCTCTCTTTCCCTCTTGCTTGTTC
ACTCCATTCCTCTCTGGTCAAATTAAAAATAAATAAATATAATTAAATAAAATGATTCTT
AAAAAACTAATCTTGCCTTGTGGGGCTAGCAGTGGTGGTCAAGGTGCTAGACCCCCACAT
GATCAGCTGTAGTTCAAGTCCTGGACCTGGAAACTTGCTTTCTTGCTTTCCCTCTCTCTG
ATCAAATAAAAAAAAATAATAATAAATAAAAACTAACAAATAATTCTTAAAAGAAAACTC
GCCTTGTATTAAAATGCACTTATTTGCCATCTATTGAGTTGTCAGACAAGTCATGACATA
ATTTTTCTGTTTCTCTATGCAAAAATGTGTCATGATTTTTCTGACAACCCAATAAATCGA
CATATATAATTTCTACATAATTGGAAACATGCAGTACATTAAAAAAAATAGGTCACCATT
TACCAAAGTCAGCTTAAAATAAGATAGAGACCTAAATGCAGAAATTAGAATAGATTTATT
ATGTGAAACTAATTGTTAGTAGTGTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved