Tupaia_belangeri Locus Mono:191:SNORD45
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:191:SNORD45
Tupaia_belangeri
Mono:191:SNORD45
GeneScaffold_1821
SNORD45
1001..1075
2075
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCCAAAAAAAAATATATATATATTTTTTTTTTTCTTCCAGTTGCTGACAAGTTGGTA
TGTATTCAGAATCTAAAGTTGATTCTACTTTAGCTCTAGAATTACTCCAAGACCTGAAAA
ATATCTTGACTAAGAGGAAACTTTAATGTTTTATGTTCTTTTTGGTCAGCTCCAACTTGC
AAGTATTTCCTTGGCAATGGGAAATTAAATTTAAAAAATTCAGATGTATATTAGTTATAC
AATATGGGCAGGACATGAAATGGTGATGAGATTGATGAGCTCACAATGATAAGCATGTAA
GAGGGAGGGGCAGCAGATGGTATAGGGATTAAGGCAGCTGGATCCCACGTGGCCAACTGT
GCAGTTTGAGTCCTGGACCCAGCAGCTTAAAAACCATGCTGGGTGCATGTGTGTGCATAC
CCCAAATCCAGAGAGGAGAATGGAGAAGAAGGGATTGCAGTGTGGCCATCCTCCCGGGGA
ATAGTTTTAGCTCTGTCTCTCCAGCAAGTGCACATGCCCTTTAGGAAACTATATATATAA
CTTTTTCCTTCCCAGTTTACTTGTGTGGAATAGAATACATGCACCTCAGACATGATTAAA
TGAAAAAGCGACCAGCAGTGCGGCGAGCCGCCGTTTTCCTTTTGTGGCATCGTGGAGCTT
CCTTCCAGGATTTGCTGGGAGCGGCCTGGTCTTCCTCCCTGCCCTTCCGCGGGTCGCTGT
GGGCTGGGTGCAGGGAAGGACAGGCAGCCGCTGAGGTGGCCCAACTGCCAAGTTTTCCAA
AGGAAATCAGGACTTTTGGTTGGCAGGGCAGTTGCTTTCACATCTGTCTTTCAGGATTTT
CTGCTGTTACTACAATACGCCATGACCCCAGCTGCCCCTTTCCTGCTCCAGAGCCCTGTC
TCCCCAGGCCTGGCAGGGACTGGAACCTTGGTGGTCATGGGGCGCCAGCCCCCTGCCCTC
GGGCAGGGCGTACTAACTCCTGATGTAGGTGGTTCATCTCTCCTTACTCACGCTGGAACT
GGGCCAGCCAGCTGCTCTCGATTCCCGCTCAGGGAGCCCAGTGGCTGAGGGCCGCTGGGT
TTGATGGAAAGATGCTGCTTCCTTGAAATCTGTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved