Tupaia_belangeri Locus Mono:154:SNORA38
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:154:SNORA38
Tupaia_belangeri
Mono:154:SNORA38
GeneScaffold_874
SNORA38
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATAATGCTCTTCTATATCATCTCTAGA
CTATACTGTACTAATTGTAATTTTAAAAATGTTTTATGTGACTCTCCTACAAAGGCGTGT
CTGTGGCTCCCTGTCTTTGGACACGTAAGAATTGGAGGCAAAGAAACGTGGATTGAGGAA
TCTGGAGCCTTCTTGCTCCTTGCAGGACTCAAGATCCACCATCCCATATAGAAGCGTTTA
TTGAATTAAGCCTTGCTAGTAGAAATTTCGGAGATTATCAAGGGCAGAGAGAGTGGTGGC
TTGTAAGAGAAGTTTGGACTACACATAATGACATTGAAGGTATCTAAAATGGCATCTAGG
GTGGGATGATGTCAGATACCTCATGTGAGGCATTCTTGACCCTCTTTCATAGAAACTCAG
ATGGTACCAGAATATGTAATAAATGGCAGTCCCTGATCCCCCAGGTCATGTACTCAAAGA
CAACACAGTTTAATCTTTTACCTGTTTCTACTAGAATTACTTTAATAATATTTCTAAATA
ATATGCTTATAGTGTGATTTTTTTTGTTTGTTTACCAACTTTAGGCATAATTTACTGATT
TCCTGCTGTAATAGATGTGCCTCAGTTTCCTCATCTCTGCCCACTTCGTTGGTCACAAAA
AGTAATGAGTCAATGTACATAATGGTCTTAGAGCTGGCTTGGCATATGGAAGTTCTTAAT
AAGCGTTAATTTTAGCATTAATTGTTATGATTAGCTTTCATTCTTAGTAAGTGCTAATTT
TAGTATTAATTATTATGATGATTAGCTTTCTTAAACTCTAACCTCTTCCTCCTAGCCAAC
AAATATAGAGAAAAACTTAGATTTACATTGCTTTATGGAATTAATTTGAGTCCTCTAAGG
AAAAATAATGTCAATAAAGGTCTTGATGCTTCCCAACCCAGTGACTTCCAAGTTGTTATG
TGCTGATGGTACTAGGGAGTACAGTTAGCGAAGTTCAGCCTTGGCTGGTAATCTTAATGT
ACGCTTTTAATGGCACAAATGTGATTTTCTTTTTTTTTTTTGGAGAGGTTTTTTGCTATA
GGGCGCGTGCACTCACCAGAAAGAGACAGAGACAGAGAGACAGAAAGTGAGAAATCACTC
CCCAGGGGGGATGGCCATGCCACAATCCCCTCTCCTCCATTCTCATCTCGGGATCTTGGG
CACGCATGCACGCACGCACGCACGCACATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved