Tupaia_belangeri Locus Mono:138:SNORA40
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:138:SNORA40
Tupaia_belangeri
Mono:138:SNORA40
GeneScaffold_5421
SNORA40
1001..1126
2126
ACTTGATTACTTCGTGATGCATTCTTTTCTAGATAATTCCAGATGTTAAAGAAGAACAC
ATCAACACTGAGCTTTAGAGAAATCTACTCTTCAGTTTTCACTTTGGTTTCTTTCTTTAA
GTTCATTTCATAAGACCAGTCCCCATGACTCTATGCTATACTCACCACGCACTTTTAGTA
CAGAAATCAATGGTCTATGGGGGCTTGCAGGTGATGTGGTGGTTAAGGTTGCTGGACTCC
CATATGGCTGACTGTGGTTTGAGTCCCAGAGCTGGTGGCTTGCTTTCTCGCTTTCTCTCT
CTCTCTATTCCTCTCTGATCAAATTAAAATTAATTAATTAATTTTAAAAAGAAATCAATG
GTCTAGGAAAATCAAGTAAATTTAATCTATTAACTTTCCTTTATTCCACTTACTGTATCT
GCCACCTAATAATCTTCCTCACTGCCACCTCCCCACCAAAGATCTCTAAAGACTTAATAA
CAACTTATACTTTTCTGGAAAGAAACCTACTCATAAAAATTACCTTGTATCAGTTGTCCA
ACATTCACACTACTTTACTAACAATAAGCTAGTTGTCACCTGTTTATGTCCCATGTATCA
GAAGTGTATCCTCTGCAATGTGGTGGGTCAAAATTGCAACCTAGTAATTCTTTACTTGAT
AAGAATTTGAAACAATTATGTCATCTCAGCAAAAGATCTTTAAATTTAACTTTAATACTT
GGGACCAGCAGGTGGAGTGGTGGTTAAGTTGCTGGACTCCCACAGGGCCAACCACAGTTA
GAGTCCTGGACCTGGCAGCTTGCTTTCTCACTTTCCCTCTCTCTCTCTCTCTCTGGTCAA
ATTAAAAAATAATAATAATCAATAAAATTAAACAAATAATTCTAAAAAGAAAAAAACCTA
AATACTTTAAAAAAAAACTTCTGATTTTTAAGTTCTGTAATAACATCTAATGTGTAAATG
AAGTTCTTAAAGCTTTCTGCACTTAAAAAAAAGTAGGGATTAGCACTTGAATTTGTTTTT
GTTTGTCTTGTAGACAAAGACGCAGAAAAGTGCAAAAAATAAATCCTCTCTTGCAACCCA
GAACTCATTGTTTAATATGAGTTTTGATACATATAAGAAGTAATATTAAAAAAAAAAAAA
GGGGGTGGAGTATGGAATAAAGAAGACACTGGGATTGCGCTGGTTGAGTAGAGAACCAGT
AGAACACTGCTCAAGTGATGCCAGATATGGAAGCTTCCAGCTTCAGTTATCTGGTCAACC
TCTACCTACCAGGCTTGAATCCATGATCTAGGCTGGCTGGGAAAGGTGGTAGCAGGATCA
TGGCATGCAACCCTATTCAGAGTGTGTACCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTCTATCTCTCACTCTCATAAAATAAACAAACAAAAGAATATACTAGATCTTCTAACTT
ATTGAATTAGCAAGAATTTAAAGGTCTTAAACATCTGTATTTCCTTTTCTGCCTTTGACA
TAAAAACCTTTTCATTTTTGGTAAGGTAATCTAAACTACTGATACTAATTGGTTTGTATC
TAAACTGATGAATTTAGAGGGCTTTTCTGTTTAGTAAGACAGGTCATTCCTTTTGTTTTA
ATCTGGTTTTTTTTTGTGTGGGGGGGGGGAGGTCTGTTTGTTTGTTTGTTTTTTCCCTTA
AGACAGTGTCATAGTCCTCCTGTCCCAACCTCCTACTTGGAACTACAGGCATATACCACC
ACCCCTGGCTCTTTTTAGATAGGGTCTCAGTGTTGCTCAAGTTAGCCTTGAGCTTCCTCC
TTTCTCAGCCTCCCCGAGTTGTTGGAATTATGTGTGCATATCACTGCATGGATTTTAGGT
TGTATGGGAACCAAACTCAGGCCGCTCAGGCAGAACCATCCCAGCTTGCGGAACACAGAG
TCTTAGCAGTGAGTATCACCATAACTGGGCCTTTTTGTTGCCGCTGTTGTTAGAACTTTT
GCCATAGGACATGTGCAGTCACTGAATAGAGACAGAGAAAAAGGGTAAGTGAAAAAGCAC
GCCCAGGGGGCGGTGAGGGAGGGGGGTGGCCATGCCACAATTCCTTCTTTTCCATTCTCC
TCTTGGAACTTTAGGCACCCACATACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved