Tupaia_belangeri Locus Mono:165:SNORA7
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:165:SNORA7
Tupaia_belangeri
Mono:165:SNORA7
GeneScaffold_2985
SNORA7
1001..1140
2140
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTGCCCCCC
CTTTGTTCGAATGGGACAGAAAAGAAACGCAAAAGAAGGAAAAGGCATGCCTGGAGGGCC
GGGGAAGGTAGCTTAGCTGATGCTTCGATGGAGGAGTTGGAGGCGGGCCTAGGGGTCTTT
CTGGCCTCGGGTATTCCGCAGCGGCAGGTCCTGTGGGCAGTTCTAAGTCCTCCTGATTGT
ATGAAGCTTTCCTGCACGGCCGGGCAGGTGTCCAGTTGCAGGTGAGCGGTCTCCTCTCGT
TGAGGGATCAAGGCCTCCCATCTAGAATGAGCCCTGTGGAGCTGGGACGCTTGGTCAGGT
GGGATTCGCTGCCCGTGCAAGCTGAAAAGGGCCTGGGGTCAGTTTTGTTTGGGGTGGCTG
TTGCCTTTTTCCTCGGGCTCTCCAGTGGGTGCGGAGCGCCCAACCTCCCAGGATCGCGTC
TGGAGAGTGGCTCGTATTCTGCCAGCTTCGGAATCGGGAGGGAGAGCAAAGCCTGCAGAG
GTACCCATTCCATTCCCAGCTGGCACCGTAGCTGGCGATTGGAAGACGCTCTGCGACAGT
GTCTACCCCGGGGCAGGGAGGGCTCCTCCGGGGTTCGGGATGTCTCTTAACACCCGTCCG
CTTCTCTCTTCAGGCGTCATGGCTGCCCTCCGGCCCCTCGTGAAACCCAAGATCGTCAAA
AAGAGGACCAAGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAGATTAAGGTACGT
GGTCTGGGGTGGCGGTGTTGGGTGAAGCATGGTGTTCCTAAACAGGGTGACGTCACCTGG
TTGGACGCACACACTAGTCTGCTGTTGGCGAAAGCTTTCCGACGGAACCCAGGTCTTCCT
GGCTGTGCCTGGTACTCGGGCTCTCGGTGCATACATTGGGGTTTAGGCTCTAAGGGCAAG
GGCCTTGACTGTCATGTATTTCTGTTTGCCTGTGAAACGGCAGAGGAGGTAGCTTACCCC
CTTGGGGAGGTCTGTGTGTGTGTGTGTGTGTGTGTGAGTGTGTGTGAGTGTTACACCCTA
GAAGAATCCCTGAATGAGACCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCATGT
GGTCGACCACAGTTCGAGTCCCAGACCCGGTGGCTTAAACTCACATTGGGTGCATGTGTG
TGTGCGTGCTCAAGATCCTGGGAGGAGAATGAAGGAGAAGGGATTGTGGTGTAGTCATCG
CCCTTGGGGGTTGATTTCTTGCTTTCTGTCTCTCTGTCTCTCTCTCTTCTGGCGAGTGCA
TGCACCCTATAACAGAAAACCTCAAAAAAGGGAGAAAAAAAAAAAAACCAAAAGGATCCC
CGGATTTTCCTTCCTGCGTGTTTCTTGTCCCGGCTTCTTGGTCTGTGAGGTCGGTTGAGG
TTGTCAGGACAATGGAGACCAGCTGGACGGGAGGGACAGGTTATTCTGACATTCCTCTGG
GATCTTGAGTGCACGTCGACTCTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved