Tupaia_belangeri Locus Mono:66:SNORA43
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:66:SNORA43
Tupaia_belangeri
Mono:66:SNORA43
scaffold_99414
SNORA43
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGG
CTTGCCCCTAGGTGCCTTTCTCAGAAGGAACACCGCTGTTTCCACGCACCGTCCTGCCCG
TTTCGGGGACTTGGGATAGTAGTCCCCAAGCCGGCTGTGGTGAGAGCGCGCGCGAAGCGG
AAACCGAGGGCCTTCCTGGCACCGGGCACCCGGTTCCGTGCAGCCCAGCGCCGCCATCAC
AGAGGACGGACAGTTGGCCCGGCTGCTTCACCGCGCCCGGCGGATCAGTTTTCAGGCCCC
TCGCGGAGCGGAGGACAGTGTGGAAGGGAGGACGTTCACGCGGGAGGTAAGGGGAAGGGG
GTGAGGGCCCGCGGGAGGTGGCTGCCCTGCAGACGCTGCGCTTTGCCGCCAGCACCGGGT
GCGGCTGCTCTGCTGTGCCCGGGCGTCGGGGCAGAGAGAACCTGGCTATTTCTACGCTCC
GTGCCCGGAAACCAGTGGGCGCTGAGAATGGTTTGTAGCCTGACACATGCTAGAACCGCG
CGGTGGCCGCTGGGTTTCTGCTCCCCACTTGGCCTCACCTGGCCTGTTCTGGGGCGCCAC
TGCACCCAAGTTCCGAGCTTGGGATTCTAGTGCCTTCCTCTGTACAGCAGGGCCCGGGGA
CCCTCAAGAAAGGCAGGGCAAGGCATGGGAGAGGTTGGGACAGAGGATGCAGGGGACTCT
CCCTGATGTGAGACCAAAATCAGGCCCTGGGGTGGGGGGAGGGACTGTACAGATGAGAAT
GTGTGTGTGGGGGGTGGAGGCCCTGACTGCCCATTACAGATGGGTGTGTGTGTGTGTGCT
GAGGCCCTGACTGCCCATCAGGGGTGGGGGGAGGTGCTGAGGTCTGACTGCCCTTTACAG
CCCGGGGTGGGTGCTGAGGCCCTGACTGCCTGTTACAGACCCAGGGGTGGGGGAATGGAG
GCCCTGACTGCCCCTTACGGGGGTGGTGGGGGGCGGTGCTGACGTCTGACTACCCGTTAC
AGACGGGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTAAGGTGTGAC
TGCCCGTTACAGACCCAGGGGTATGTGTGCTGAAGTCTGACTGCCTGTTACAGACCAGGG
TGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACTTAGGGTTA
TGTGTGACTGAATGTCTCACTCTCTGTACAGATGGGGGGGGGGGGATGCTGAGTCCCTGA
CTGCCCCTTACAGACCCGGGAGGGGGGTGCTGAGGCTCTGACTGCCTGTTACAGACCGGG
GTGGGGGGGTAGTGCTGAGGCCCTGACTGCCTGTTACAGACCCGGGGGGTGCTGAGGTCT
GACTGCCCCTTACAGACCCCGGGGCGTGCTGAGGCCTGGCTGCCCCTTACAGACCCCGGG
GCGTGCTGAGGCCTGGCTGCCCCTTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved