Tupaia_belangeri Locus Mono:68:SNORA29
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:68:SNORA29
Tupaia_belangeri
Mono:68:SNORA29
scaffold_7794
SNORA29
1001..1140
1665
TCTGAAACCACATTGCAGCAAAGCAAGAACTACCTTTCACAGCTCTCTAGGCATTCATC
TGAGTACAAATATTAGAGGATTCAGCACAATGAGGTCGCATGCTGAGAACAGAAACTGAA
ATGCCAGGGGGCATATTAAAACCAGTGTAAATGATGCAATTCAAGGCAGAGAGCCATCTA
TAGGCATGCATTTACTGTTAATGGAAAACAGAGGTGGCAGCAAGAGATACAGCATTTCCA
TTTCTCTTTTCTTGACACAGAAATCATTTTTTAATACAGAATAATGCATAGGCTGGAGTA
CCTTCCAGGAGGTGTGTAAACATTCCTATGTTAAGCACAGTGGTAAAAGTCAAAATGAAA
TGTAATGAAAATCTTGCTTCAGGATTTATTCCATGTATTTCAATCACTGAACAAATTATG
GAACACCTACCATGCACCCACCACCATGCTAGGTCTAATGAGCAATACAAGGGAAGATAA
AGACACAAGTTTTGTTCTTAAAGATTTTGACAAGATAAAGACAAGATTTCCTGCTTGACT
CCCACATTTTCTCCTGATAATAGATTTTAGTGGCTATTCTTATAGAATAGCTTAAAATTG
CCATGATCTGAAGAAAGAGGGTTTTTTGGTGACCTCCTCTAATATGAGATGGCTGAACAG
GGGGAAAAGGAAAAAAAAAAATAAGACTTAAAATATAGACAGCAACAAAAGCCCAGACAA
GATGGTATATACTCAACTTTCTAAACCCGCTTGTTTAAAAATATAAGTGTTATATGATAT
AGAAAAAAGAGAGCATGTGGGGCTGGAATAACTGGAGGTAACATCATGAAAAAGAGGATC
TTTGAAGAATAAAAATCAATTTAATCACAACAAAGAACGAAATAGGTAGTTTATTTCCGG
CAGGGGGCAAAACCATGCAACCATACTGAAATAAAAACAGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved