Tupaia_belangeri Locus Mono:216:SNORD82
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:216:SNORD82
Tupaia_belangeri
Mono:216:SNORD82
GeneScaffold_6082
SNORD82
1001..1071
2071
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTGTAGGGCGCGTACGCTCAC
CAGACAGACAGAGAGAGACATTGAGACAGAAAGCGAGAAATCACCCCCCAGGGGGATGGT
CACGCCACAATCCCTTCTCCTCCATTCTCCTCTCGGGATCTTGGGTACGCACGCACACGC
GCCCGGCGTGAGTTTTAAGCCACCGGGTCCGGGACACGAACCACGGTCGACTACGTGGGA
GTCCAGCGACATAGCCATTACGCTAACTGCTGGCTCCCTCCACTGAAGTCTTTTGACAAG
GTCATCAAGATCTTCATATGTCTAAATCTAATAGGAATTTTTTGATTCTTATCTTCCGTT
CCAGTCTACTCTATTAGCAATAACAGGAAGTAGTCCAAACAGGGTGATTTATAAAAACAG
AGGTTTATTCAACTCCCACTTTAGAGCTTCAGGCCCTGATGGGTTCTTCTGGCTGCATTA
CAACATGGCAGCCAGCAGGAGAGTGTAGTCTGTGTTCCATCTATCCGTTTCTCTCTCTCT
CTTTCATCCTTCCTTATTATAAACCCATCAGGTGTCCGTCATGGGGACCATGCCCTGATG
ACCTTAATCCTAATCTCTTCTCCCTTTCAACACCATAATTGGATCAAGTTTCGCCCTCTT
GATCCCATTACAATGGTTCAACAAATGAATTTGGGGTGATATATTCAAACTATACTATCT
TCCATGTTATTTCAAAAGCATTTGTAAGAGTTTACACAGTTGACACAAATGATGTTTGAC
ACAGGGACTTAATACGGAAACCTGATACTACATTTGCAATGTGCTGATGTGCTGTGTTAA
TAAAACAAAATAATAAAATACTACTACTACTAATAAAAAGAGTTTACACAGTTGAGAACA
ACAGTTTTCCTCTTAAAGCAAAAAGCACTTCATTCACTTATGAAAAAAATAAAATCTGCC
AAATACTTGAGTTTGGAGAAGTTTTATTTTTTATTTGTTTTTATTTATTTATTTATTTAT
TTTGCTATAGGACACGTGTGCTCGCGAGAAAGACAGAGAGAGACAGAGAGACAGAAAGCG
AGAAATGATCCCCCCGCCCCCCGGGGAGATGGCCGTGCTGCAATCCCTTCTCCTTTATTA
TTCTCCTCTCAGGATCTAGGGCACGCACGCACACGCACCCAGCATGAGTTTAAGCCACTG
GGTCCGTGACTTGAACCTTGGTTGACTACATGGGAGTCCAGGGACATAGCCATTGCACCA
ACTGCTGGTCCCCCAAATACTTGAGTTTGAATAGCCATAGTTTTGTCAGTTATTTTTCTC
AAGTGAAAATGGAGTTCCATGAAAAATGTAGCTAGTTCAGTTTGTAACTCAACTGAGCAA
GTTATTTTTTTTTTGAGATGATCATAATACTTTTGGATGCAAAGATGCATTATCCGTACT
TCCTTTATAGTCACCCAGAATATTAATAAGACCTGTACTCAAGGATTGTAATTCAATACA
ATAAATACTTCTTGCTGCCTCACCAGATAAAATTGAGTTTTTCTTCTTTTCTTTAAGTGT
GTGGCGATGAAAGTTACAATGACTGTTAGTACAGTCTGATGCCACTGCCTTGATTTGTGC
CACGGTACCAGCAGTTTTATCCTCCATCTTGCACCATCACTGAAAATGCCCATGTAGGGA
AAAAGGTCAAATAATGACTATTGTTATGCAAACAGTTTTGATTTTGTGGTGCTTTAGAAA
GGGGCCTCCATAGATGACAATTTGAAAATCACCATTTTAGGTTAAGCCAGATTTACTTCT
CTTTTTTTTTTCATAGAGGTTTTATCCTACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved