Tupaia_belangeri Locus Mono:106:SNORA49
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:106:SNORA49
Tupaia_belangeri
Mono:106:SNORA49
scaffold_104598
SNORA49
1001..1135
2135
GGCACGTGGTGCGTGCATGCCCAAGATTCCGGAGAGAAAAGGAGGAGAAAGGATTGCGG
GTGTGGCCATTCCTCTAGGGGGTGATTTCTCTCTTTCTGTCTCTCTGTCTCTCTCTGTCT
TTCTGGTGATCGCATGTGCTCTATAGCAAAACCTCTCCACCCTCCAACAAAAATAGTTGA
TACGGTTTATGTAAAATCTACCATCTTGCTGGTTGTTTGCTATGTGTTTTATTTGTTCTT
TCTTTTCTTTTCTCTGTGCCTGCTCTCGATTTAATTTACAACTTAATTTTTCTCCACTGC
TGGCTTATTACTTACATATCCTTTTAAAGTTTAAACATCTACAGAGTTTACAAAGTACAT
TTTTAATTTACCATAGGTTACCTTTAAATGATACTGCACCACTTCTGTAATAGTTATGAG
AATCTTCTATAACAACATATTTTTTAAGACTTATTTTACTTAACTTTATGTATTTATTTA
TTTTAATTTGACCAGAGAGGGACAAAGAGAGAGGGAAAGTAAGAAAGCAAGTCTCCAGGT
CAAGGACTCAAACTGCAGTCGGCCACATGGTAGTCCAGGGCCCTTAACCACCAGGCTACC
TGCTGGCCCCAACAACATATTTTCAATTCTTTCCTAGCTTCATTCATGTTAGTTTTTGTC
ATATATTACATGGAGCATGTCATGCATTACATGCTTTGTCTGCATTTCATGACATGTTCT
ACAAATCCACAATGCATTGCATCTATTTTTGTTTTAAAAACAGTTTAAAGGAAATGCCTT
TATATTTACCTTTATTTTAACTATTTCTGGAACTCCTATGTCCTTGTATAGATCAAGATT
TCTCCACATATCAGTTTCTTTCTGAATGATGAAGTTCCTTAAACATTTCTTGTAGCACAA
GTCTACTGGCAATACTTTCATTTTCTGAAAGGAAAAAAAGTCTTTATTTTGCCTTTAATT
TTGAAAGGTACTTTTTTTCTGGGTATAAAAACCCAGGTTGACATCCTTAGCCTTACTCCA
GGGGTTTTCTGCCCGTAGAGTGCCCTGCCCTGACATTGCCTGAGGAGAGAGCGAGAGCAC
GTTCCCCTCCCCAGAAACATGCTGTGTTCTGTGAGGCCTATGAATGAGTTGACAGTAGGA
AAACTGACAAAGGAACAACAAACCCGGGTTGACAGTTGTTTCTTTCTCACTCCATCATCT
TCTGTATTGCAGTATTTTCATTTGATCGGAGAGGGAGGAAGAGAGGGAGAGAAAGAAAGA
GAGAAAGTGAGTGATAAAGCAAGGCACCAGGTCCAGGACTTAAACCACAGTTGGCCATGT
GGGAGTCCAGCATCCTTAATCACCACGCCACCTGCTGGCCCCGCCATCTGTGTAACTTCA
TCAGTGAGGTGTCTGTTCAGATATTTTGCTTATGCTTAATTGGGTTGTTCTTTTTTAAGT
TTCAAGTCTTTTTTTTGGGTACATTTTGGATAATAGTCCTGTTTCAGGTATGTTTGCTGC
AAATATTTTCTCCCAGTCTGTGGCTTGTCATCTCACACACACACACACAAAAAATGTCAG
AGGGCATGCACTTGCCAAAGAGACAGAGAGAGAAAGAAAAAGAGTGACCTCTCAATGAGG
TGTGATCATGCTGCCATCCTTTCTCCGTTTCTCCACTCATACCTTTGATGTTGAATCTAA
AAAGTCCTCATTACACTCAATTATATCTAGATATTCTTTCTATGTTATCTTCTCACTGTT
TAAAGTTCTGTGTTTTATATTTAGGTCACAGACCTAAATTTTGAGATAACGATTAGGGTT
CTTCTTTTCCATTTATAATTTGAATTTTGTTGCCTCTTCTCTCTTCTTTCTCTTTCTTGA
TGAATCCTTTTTTTTTTTTTCCTTTTCTTTTCTTTTTTTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved