Tupaia_belangeri Locus Mono:19:SNORA49
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:19:SNORA49
Tupaia_belangeri
Mono:19:SNORA49
scaffold_66959
SNORA49
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAGGCGGAGCCCGGTGCC
GGGAGCAGGGCGGGCGGGGTGTGGTCCGGGCTCGTCACAAGCTCTGACGTGCTCCGTCTC
CCAGGCAAGTTGGAAGCGTTGGCCATCTTGCTGCAGAAGCTGAAGTCTGAGAGCCGCCGC
GTGCTGATCCTGTCACAGATGGTCGTGATGCTGGACATCTTAGAGCTGTTCCTGAATTTC
CACCACCTCACCTACGTGCGGATCGACGAAAACGCCAACCGGGAGCAGCGGCAGGTGAGG
CGCGGTCCCGTGGTCCCAGCTCCGCCGCCTGCCCTGGTCTGTCTGCCTGGTTTCTGAGCG
CTGTGTAAGTTTCCAGCCAGCACCGTCCTCTGGCCTCATGACAGAGGGCCACGGCGTCCC
AGCAGGGTGGTGGCTGCACACGTGTGCACACAGGCGTGGCGGTGACCTCCAGGAGCAGCT
TGGAGGGAGAGCGTGTAGCCATGCACGTGGGAACGCAGGGCTACCCGCTGGGCTGCGTAC
CCTCTCTGCGTCCCGTGGGGCCATGTCGAGGCCCTGGGCACGTTCGGGTGGCTGTCCTCT
TGGTTGGCCAGCTCTCAGGTTCTGTCTTGGCGTGGGGGTAGTTCTGGAAAGTCTCCCATC
AGGCTAGCCAGTCCTCGGCCCGCGGGGGGTCCCGCCGCCACCTTCCTCAGCCTTACTCCA
GGGGCTTTCTGCCCGTAGAGTGCCCTGGCATTGCCTGAGGAGACAGCGAGAGCACGTTTC
CCTCCCCAGGAAGACACTGTTCTGTGGGGCCTAAAACGAGCTGACAGGAGCCGGGAGCTG
GGCTCTCGTGGCCGTCCCCGTGATGGGCTTGTGCTCGTGTGTCGTCCTGTCTGTGGCCAC
AAGGCGGCTTGTGGCCTTCACACTGTCACAGGGATGTCTGACCACAGCGGAGCAGCGGGG
GCCGACGCTGCCCCCCAGTGCAGACCCGGTCAGGCGGAGCGAGCCAGCAGTGAGGCTGTG
GGGTAGTTCTGTGGGTAAATGCCGACATCACCAGGGTCTTCGGTGTCGGGGTGCCGATCT
GCGGTCTGCTCCCTCGTAGGCGCTGATGAGGAGCTTCAACAGGGACAGGCGGGTCTTCTG
TGCCCTCCTTTCCACGCACAGCCGGGCCACGGGCATCACCCTCGTGGAGGCCGACACCGT
CGTGTTCTACGACAACGACCTGAACCCCGTGATGGACGCCAAGGCGCAGGAGTGGTGCGA
CAGGATCGGGAGGTGCAAAGACATGCACATCTACAGGTGGGGCCCTCGGCGGGCGTGTCC
TGCCATGGCGCGTGCTGCGGCCTGGGTCTCGGCTGCGTCCCCGCTACACGAGTGTCCGCC
CTGCCCCCCTGCCAGCCTTCAGCCGCAGCCAGAGGCTTGCCTAGCAGCAGGCACTGTGCC
CTGGGCGTCACTGTCTCAGTGCCGGCTGCCGTGCCTCTTCCCGAGGACCTGCACCCTAGG
GCGCTCTACACGGGGCTGTGACGGACGGAGCGGGTCGCCAGGTCCGCCTCTGCTCCCGAG
CCTCGGGGCGCTCTGCACCGGAGCTACTGGCCCTGCTGTCTGCGTCCTCACTCACCCTGA
GCACAGGCTGCGTCCCCTGTAGCCCTGACGTCGGCGCACCTTATAGCTAAGACCGGAGCG
GTCCCTGGGCTTTGGTTCACAGGGTGGCTGGCCTGGCTCTGGGGCACCAACTGTGTCGTC
ATCCCACGGGACAGCTGGCGCCAGTTCCCCCAGTCGTGGCGTCTGTTTGCCGCCCAGGCT
TGCTGACAGCGCTTGGTCCGTTCACGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved