Tupaia_belangeri Locus Mono:79:SNORD60
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:79:SNORD60
Tupaia_belangeri
Mono:79:SNORD60
scaffold_143427
SNORD60
1001..1083
2083
TGACGGTGCTCACGGGACTGCGATCGTGCTCTCCGCAGTCTCCCGGCGCCCAGAACAGT
GCCTGGAGCAGGCAGTGCTCAAGAAATGCAGGAAGAAAGGAAAGACTAGAGAGAACAAGA
GGACGAAGGAGCGGAGTGACGGACGGACGCAGCCTCCGGCCTGCCTCAGCCCCGCCCCCC
AGGCCGAGCCCAGTCCCCTGACCCCGATGAGCCCGACTGCCCCACCGCGAGACCCCGAGG
CGCGAGCCCTGGACCAAGCGCGCCGCGCGGTCACTCACCCGCCCGTGGCCGCCCGGGAGC
GGCAACGCCACCTTCCCGTTTCATCGTGCCCCCTCGGCCGCCGGCCGGGGAGAAGGGACG
AGACGCGCGAGCCGGAAGCACTCAAGCGCTTTGCCCGTCGGGAATGTAGTTCTTCGGCCC
TCGGGACCCAGGCTGCTGCCTTATGCACGGCTCTTCGGAAACTACGACTTCCGGCGTCCC
TGTGGCCGCGCAGCGGGATTGGCGGCTTCAGAATCACTCTATGTTGCAGATCGGAGTCTG
ATTGGCTGGGTACACCCATCGCTCACAGTGAGACTCCTGGTCTGTCAGGAACAGAGGAGC
TGCGAGTCTCGGCCAGAGAGACCGCCTTTCCAAAGAGATGCCACGGCACGATTGGTGGAA
ACAAAGGGCTAAAGAGCGGAGCCTATCAGCGGCTGGGGGAGGCGGGCACTTCCTCCAGGA
TTGCCCAATTACAGCGGCGGGAGCAGTTTCTATAAAGGCTTGAGCTTCGCGTGTGCGCAT
TCTTTTGGATCGTGTGCGAGGTGGTGGTGTGTTTCTGTATTTGATGTTTGCTACAGTCTG
GAAAGGGATTGTATACTGAGGGGGATTTTGAAAATCGCCGAACCCTGCATGCTGGCCTTG
TCCCAAGTACTTAAATGATTTCTCCCTCCAAAACCTCCCGACTTCCTACAGCTCTCTGCA
GGTAAGACCAGGCCGAGTCTGGGTTCCCCAGTGCAGCGCCGAGCCTGTGATGATTTGCTT
TGACTTCTGACACCTCGTATGAACTCTGCACACGCAGTCTGATTATTTTGCAAGACTGAG
GCTTGGAGTGAGCCCTCTTACACGGGAAGTGGTTGGGAAGGGTAGTGAGTTTTGCCCGAA
ATGGAGGAGGAAAGCCTTTCTACATTTCGCGCTGTCTGGTTTTAGGTTCATCGTGAGCTG
GCGACAAAGCTGGAACCTAAATCGACCTTAATCCAGAAGCCAAGGGGCAGGAGGGTATGG
TAAGGTAGGCGTGTCTGTCTGAACTGCTTAGCAATAAAGCAGAGGCCCGTCTTCACTGCT
CTCGAGTCGTCATTCGCGTATGCTGTGGTACGCCAGAGAACTGCATGTCGAATGGGCGAA
GGTACAAAACGGAAGTTTATTAACCGGTGACTTTACATTTCTTGGGACTACCTTCTCATT
GCTACTTGTAAGGTTAAAAAGGTGACTTATGTGTTTACCCTCAGCAGCTCTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved