Tupaia_belangeri Locus Poly:3:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:3:SNORD116
Tupaia_belangeri
Poly:3:SNORD116
scaffold_9992
SNORD116, SNORD116, SNORD116
1001..1094, 3934..4025, 6668..6761
7761
TCTTCCTGAACACCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TATTGCCATGGTAGTTTTCCCCTCTTGGAGTTTGTTGGTTGAGTTGTAGGTGTGATCCAC
CTGCGAAAGCACCTTGAGATATGTGTGCTCCTTGTCTTGTAGACACAGGAGGGAAGCGTG
TATGCATTTTGGTGTGAAGTGTCATCATGAGACGTGGCTGTTACACATGCTGACGGGCCA
ATTTTCGGATCCTGTAGAGGTGAAAGGCTCGTCCTTTCTTTGGAAGTTCGTGGTGTTCAG
CATGAGGATGGCAGGCATAGGAGAAGTCACAAAAAAGTTATGTGCATACTGAGATACCCT
TTTTTACTCCTATGTCTCTCATGGTATGACAAAGATAAATACACACACTCAGACACACAG
CCATCCCAACACTTGTTTTTACAACTACCCACCTAGTTCAGTGGGGACCCAAAGCGACTC
AGATGATGGTAAGAGACATGAGTGTCTCCCTGTGGGCATCAATGACATGCACATTTTTCT
TGTATACCTGGGTTCATTTTTCAAGCATCATATGGTTTCTCAATCCTACTCAGTGGGACG
TGCCCTGGTGGGCTGGCCGCAAGCACTGAAGGAGGAGCATCATTTCCTGGGAGGACTGGA
CACTTGGTAGCCCTCTGATTCCGTGGACTGGAGTGCTTTTGCTGCACGCAGATTGCCCTG
GATGTAAGCATACTTTGCCCTGTGTGCTGACCCTGTCTTTAGCATGTGGACCTTAAAGGA
CCTAAGTGTCCACATGCCTTCAGTGGCATGCCGAGTCATTCTTATCAAGTTGAGTGTCTG
TTCTTGTTGCTCAGTGGCTAGAGTGCTGATGGTCCTTGAGGTAACTGGCCTGCCAGTGCG
CTGCCCGTGGTGCTCAGCTTTCGGCCTCTTCAAATGTGCTTGGATCGATGACGACTCCCC
AGTAAATATTCCTTGGAAAAGCTGAACAAAACGAGTAAAAACTCCCTATCATCGCTTTCA
GCGAAACTGAGGTCCAGCATGATGCCTCCAACAGAGACTCTGGGAGTGAGGGTCACTCCA
GTTATATACAGTTTGCCTACCAAACCCGGTGTCATGATTCAGTGACCTCCCATCTCAAGA
GACACAGACACACGTCTTCAGCCAGAGGTGCCCTGGTAGCAAAGGATTTGGTTGACTGGT
CCCCCTCTGGTGACTTAGCATTTTTGCAGCCAGGCTTCTGAGTCAGAGGATGGGTGAGCT
CCTCACATAGCACTGTTTACATTTTGGGTCTTTGAGTAGAGTTCTTCGTGTAGTTAAGCA
GGACCCAGGGTCCTCCTTTCCCTGGTGAGGACACAGGAACCAACCTTTCGCATGACCTGT
AGTTGCTGCTGAGGCACTGAGATCTGGGAGCCAGAGTGGAGCAGCACAGAGGGCACAGCT
GGCAGCACCTCTTGTCCTGCCCCACATGCAGAAGCCTGCCACAAGGTGGCCCAGCATTAT
CTCCAGCCTAGTGCTGGGTCACAGTGTTCGGGCATCGAGGTGCCTCATGGTTCTGAGCTT
GAATGACAGCCTTGGCAAAGCCACAGAGGGCTTAGGTGGCCATCCATGCCACAGACCATC
TCGGTACTCAGTGAATGTCTCTGGGCAGCAGAGTGTGCTGTCCTAGGGTACGGTTTTAGT
GTGTGTATGGGACTCCCAAAACAGGCCCCTGCACTTCAGATGTTTGGGGTAGGGTTGAGG
GGGTTACACGGTTCCCTCCTTCATGCCTACAAATGTACCCACAATTGGCCGCCTCTTAGG
CTTCAGCCTCTCAGAGAATTAATTGTCCTTATTCTCTGTACTGATTTCCAGAGAGGTCTT
GTCATGGAAATGTTGCTAAAAAATTCATGTGCTTTTGGCGTGCTTAGCTTGTGTGGGACT
TGGCCTCCATGGAAGTCCCTCCTAGTCCCATTCCCACTCTGTAATCTCTGGCTCAGAGAC
ATGGATAGCCATTCTCATCGGGTAACTTCTGCGTCTTTCCATATTGGAGGTGCTCTGTGT
GTCAAGCTGTCCTCATTTGGGTTGGTGAAGTGCTCCAGTTGCCTTAGCCCGTTCTCTGTC
TCAGCATGGCAAGGACTGCATGAAACTGTGACCCCACATGGAGATTAGTACTGGTCGTGT
TCCTGGAGAGCTCGTCAGTGCACATGTGCCAGTTCCCATGAAGACTGTGTTTGTTCCCGT
GTTGCAGGCATGAAGTGAGCTGTTCTGGGACTGCACATTCTGTGAAGGCTGTGTAGTGAG
GCATGTGGGGTGAGGCATGCCATGACAGGGTTGGGGATGAGCCTTTCTTGCCATCAGTGC
TGATCCTGGCGCGTCCTGATTGTAAACCACTGTTTTCTTAGAACATGTCTCATTGAGTCA
TTGGTCCTATTCATTCTGTCTGTATTTCCGTCAGCACGACCTCCCCTCACCAAACTCAGC
AGCAAGTACCAGGTCTGGCTAACAGCTGGGCCATGTGACCTAACCAGGGAACAGAGCTCA
AGGACAAAAGCCACAAGAGACTCTGTTCATTCGCTCAGTGGGGGCACAGAGAACCAGTGG
TCTGGAGGCCGAGTGTGTGCTGAAGGTTGTCACCCCTTGAGAGGTGGCTCTAGTGCTTTT
AGGCACATGTGTCAGGCCGGTGTCCTGTCCGGGTGGAGGTTTCTGTGACTGGTGTTAGTG
GGTAGTCAGTGCACACCACCTGGGGGAGTACCCACAGACCAGTCCTACTGCTGCCCTTAC
AGATCCTTGGAGGAAGCGTATGCACACGTGTTACGTGGTCTAGCATTCACCGTGCCTACG
AGTTGCACAGACTCTTGTTCAGGATTTTAGGACCCATCAGAAAATAAAGGTCACATCCTC
TTTTATAATTCCCTAGTGTGCCCCGGGAGGATGTCAGGGTATGAGAGGAGTATGCAGTTG
TCAGTCCTTCAGGTGCTGAGGTACCTATGTGTCCTCCCAGGAGCCAGGCACATGCACTTA
TGTAGCAACACAAGCATTACCACAGACACATATGTATACAGAACACACAGACTCACACAC
ACCCCAACTCCTGTTTCGAGGTTTTCAGAGTGCTATGAGGACCCGTAGTTATTCAGATAA
CGGAGGTGATTGAGAGAGATGGGAGGTGCTCTTCCGGGCGATAGTGATAAGGAGGTATTT
CATGCTGTATACATGGGTTTGTTTGTTTGTTTGAAGGTTTTGCCATAGAGCACATGCACT
TGTCAGAGTGAGAAAGACAATAAGAGAGAAAGTGAGAAATCACCCCTTCCCCCTGCGTTG
ATGGCCATGCCACAATCCCTGCTCCTCTATTCTTCTCTGAGGATTTGGGGCATGCATTCA
CATGTGCCTAGTGTGATTTTTTTTTTTAAGCCACCGGGTCTGGGACTCAAACCCTTGTCA
GCCGTGTGAGAGTCCAGTGACTTAAACACCACGCCACTTGCCCATGCCTCTGGGTTCATT
TCTTAAATGTGCATATAATTTCCCTACTTAGGGTAGGTGCCGTGGCAGCCTCACCATGCT
CTGAAGGAAGAGCTCCATTTCCTGGGAGGACTACAGGCCCTTGGCCGTCCTGTGATTGGG
CATCTCGGCTGTACTTGTTGCAAGTGGATTGCTCTGAAAGGTAAGAATGATTTTGCCAGA
TGTACTGATACTGTCTTTAGCATGTGACGGCTCTGGAGGCCTAGGTACCCACAGGACATC
AGTGGCATGCAGAGCTGCCATTTCTGAGTGGACTGCTGTTCCTCTTGCTCAGTGGCAGGC
GTTGAGTTCTCCAGCACGTTGCTGGTCTGTGAGGTCATTGGCCTGACCAATGTCCTGCCT
GTGATGTTCATCTGGCATCCCTTCAAATGTGCTTGGATCGATGATGACTCCACAAAAAAC
ATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACTCACAACCGTCTCTCATCAGAACTG
AGGTCCAGCACAATGCCTCTAGTGGGGAGTGTAGGAGTGAGGTCACTTACCACTCTTTAC
ACACGCATTACACTAACTGGGCATCATCCAATGGGAGTGTCCTAGCCTATGGAACTTTGT
TTGATGTGCTCAGTAGCAGAGCCCCTGGTTGGGCCTCTCTGGGCACTTGGCATCCATACA
GTCATCCAGATTGTAGGTGCATGTGTGGTCTGGACCTGGTGAGGTCCCATCAGAGATATG
CATTGCTTTCATGGGCTTTCATGCAGAGTCCCCTGTGTCCTCTGTCCTTGAGCAGAGTCC
TAGGCCCCTTCCCTCATTAGAATACAGAGCCTGGCCTGTAGCATGGTATAGTACTTGCTG
CTGAATGCCAATGGAAATGACCTGGGTAGAATGAATAGGCCTTAAGAACAAAGCAGTTGG
TGACTTGTCAGGCACCCCACATGCAGGTGCCTGTCATGTGCTGGCTCCCCATGTCCTTGG
CCATGTGCTGAGGCACAGAAGGCAGGACTTCAGTGCATGCATGGAATTCTGAGTGTGCCC
TTGTGCACTTGTGCTGTGCATGGGGTGGCTGGTTGTCTCCATGCCTCCACTTGGCCCAGT
GGGCACAAGTGATGGCCAGCCTCCTCAACTTAAGCTATTCTTGGTTATAATTTTCCTGAA
CTTCTGTGATGTTTTCCAGAGAGCATGTGTCAGGAATATGCTGCTAATTAAGACACATGC
CTCTTTCATACACAGTTCATATCAGTTTATGGCTGTTTGGTGTCTCCACAGAGCTCCATT
GTAATTCTGTCCCCCCAGTCCACATCCCAGACTCAGGGCCACAGTCATCACTTCCCAGTT
GGGTGACATTCATGTCTACTGGTATTGAAGGTGTCTTGTGCATGAGTTCCCTTCTCGTTT
GGATCGATGAAGTATTTCAGTGGCTTGGTCTGTTTCCCTTAGAACCTGGCAAGGACCACA
AGAAATGTTGACTCCCTTCCAGTTGACTTTAGGAAGGTGAAAATGAGTCCTGACGGTACT
ACTTGGCAAGATCCTTAGCACCCATGTTCTGAGAGAGGTGGACTTCATGTATGTTTGATC
AGTTCTGTTCCTTGATTTGCATGTTTTTGTTATGTTTTGTTTGTGTGTCTGTGTTTTTAG
CCAGAGGGAATATGTGCTTACAAATGCGGGTCATGGGGTGCATGTGTTGATGTAGTTAGT
GGCCTGGGCAGGAAAGGAGCCATGAGGAAAACTCGTAGAGGATTTAGGTATCTATCCTTG
TCACAGAGAGAGCCAGACAGAGAGGGAAATGAGAAAGCACTCCTGACCCCAGGGGTAATG
GCCATGCCATAATCCCTTCTCTTCCATTTTCCTCTTGGGATTTTAGGCACACATGCTCAC
ATGTCCTGCATGATTTTTTAGCCAAAAGTTTGGGACTTGAATCATGGTCGACCATGTGGG
AGTCCAGAGCCTTAACCACCAAGACACCTGCTGGCCCAGATTTGCACATTTTAAATGAGG
CACCGTGAGTGTGTGACATGCCTGGACAATGGGGAGGAATGAGTTTTTTGGCCCTTGGTG
TTGCGGCAGTTCTGTCAAGTTGGGAAAGCCCCCCTTTTCTTAGCCTGTCTCATTGGGTCA
TGATAGCATGCAGAATGAACAGACTGGAGGTAGGTAGTCTCGAATGTTGCACGTTTTTAG
TGATCCCTAGTGCCCTTGAACCAGCGACTCATATGAGTACCTGTTCATGGTCGTGGCTTC
TGGAACTAGTGGTTGTGGGTAGTGTGGTAAGTGTGCTTTGTCTTGGAGAAAACTCACAGA
TCCTAACTGTTCATTGTCTTTATGACCCTGGGGGGAACAGTGTATATGCATGTGCATGGA
GGTGTCAGGATGGGCAATGGCTGTCAGACACACCAGCTTTGGTATATCTTTGAAACCTGA
AGAGGTTAAAGGCGACATCCTTTAGTTGGAAACCCCCAGTGTTCAGCAGGAGGGTGGCAG
GCAGTGAGTGGCAGTTCCTTAATGTCTTGGGGGTACCTGCATGTCCTCCTGCGAGTGAGT
TGGACACACATGCACACCAAGAAACATGGATACATACACACAGAGGTGCACACATAGAAC
TGCCCTGACACCTGTTGTGCAGCTGTCTATCAGCTCCACTGTGGGCCTCTGGTTACTCAT
AATGGAGCAAAGGAGAGGGAGATGTAAGAGCTACCGCACAGGCAACAGTTGCATGCACGT
GTTGTACTGTGTACCTGTCTGGGTTTGTTTTCAAGCATACATGTCCTTTCTCTACTCAGT
GGGAGGTGCTGTGACGGGCTCACTGTGCACATGGAAGGAAAGTCTCTGTTTCCCGGGGAG
ACTGTGTGCTCTGCCATCTTGTGAAGTTGTGCTTGGGATGCAACCACCACAGTTGGGTCA
CCCTAGACGGTAAGCATGCCTTCTCTCTTTGTCCTGGCAGTGTTTTTACCGTGCAGTGGA
CATGGAGGTGTCTAGGTGTCCACAGGCCTTTACTGGTGGGCCAGGGTGTACTCGTGGAGT
GGGCCGTTTGCTCCTGTCCTGTGGTGGGGTGTGCTCTGGCTGTCCTGGGCACTGACACTC
TTGGAGGTCATCAGCTCACCCGGTGCTCTACCTGCACTGCTCAGCTCGTGGCCTCTTTGG
ATGTACTTGGATCGATGATGACTCCCCATAAAACATTCCTTAGAAAAGCTGAACAAATTG
AGTAAAAACTCAGTACCATCACCTTCATCGGAACTGAGGTCCAGCACAATGCCTCTAGGA
GGGACTCTAGGAGGGAGCGTCACTTCCCACATTTGTACACAGTCATCCCAGCACCCAGGG
AGTCAAGCAGGGCAAGCCTCTCATCTTAAGGCTCACGGCAATCTGTGGTCAGATAGCAGT
GTCCTTGGCCGAGTGGGTCACTCCATGGCACTGCTCTGTGCTGACTGTCATCTGGGTCGT
AGTAGGCGAGTGTGCTGGATGAGGTGCTAGCAGAGTTCTGCTGCCATTGCACCCCTCATG
GACAGGTTCTCATGGCTTCTTGGATCTGAAGACCAACATTCCATTTCCTGGTGATAGATC
CAGGGGCTGGCCCTTAGCCAGGCCTGTTGCATTCTGCTGAGGTTGCTTACGAGAAACTGT
TACCAACGGGAGTGATGCTGACAGTGACCAGGTACCAGGGACACAGCTGGTGGCAACTTG
ATTTGCCCACATGCAGAATGCTATCTTGAGATGACCTGCCATGTGCTTAGCCACACCGGG
CTGGGGAGTCTAGGAGCTGAGGTGGTCAGTGGCCCTGACAGGAAGAAACGCCTTGTAAGA
AGTCCAGAGGGTTTCGTGGCCATCCATGCTGCAGGCTGTTTTGCCCTTTTGTATTCATGT
CTTGTTTTCCTTCTTCTGTGGCTGAAATATTGTTAGACTACATTTACACTGTATTTTCAT
CCTCTACTTCAAAATATAGCTGTGGATGGCATCAAACACCTTTGTACTGGGTGGTTGGAG
AACAACCCAATTTTTGCATTTTTGCATAGAAAAACAGAAAAATATTCAATGACTTTTCCA
GCAACCGAAGAGAACAAATGCCACAAACTCTTCTAAGGTTTTACAGGTCAATATCATATG
GTATTAGGGTCATTTGGTATTGTTTTTTGTTGTTCTACGTAGGCAAAAGTTTGTTTTTAA
TTATTCATGGTGGGCGAGTGTGCCAGCTTTCACGTGTGCTGTTTTCCTCTGTGTACTGTT
ATGATAGCAGATGCTCCTACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved