Tupaia_belangeri Locus Mono:200:SNORA40
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:200:SNORA40
Tupaia_belangeri
Mono:200:SNORA40
GeneScaffold_5704
SNORA40
1001..1129
2129
ATAAGTTTGTTCTTCCTGTAGTACTGCCTCAGTCCACCTTAGACAGAGACAGGATCCTT
CTGTTCAGGTGAGAGTCATGGTTAGGTGCTGAATTCTCAATTGTGCCAACGGTGGTTCTG
AAAAAGTCATTTTTATAAATAATATTGACCTGATATTGATTGTGCCAACTGGTAGTTCTG
TAAAAATGATTTTTATAAATAATATGTTTATTATTTATAAATAATATTAGCTTAATATAT
GAAAATATTTGAAAATTGCACTGTTGGAGAACCACAATCGACCACAGAGGCCATCTGAAG
TTGGGACAGTTCTCTTAGACGTTGATGGCTTTGTTTCTCGAGCACCTTCGCTCCCCTCTG
GAGGACGTTCCTGGTCACAGGAGTGGTCTTGGCCAGCGTACAGGGAGGTTGAAAGTGCTG
GGAGGTAGCACTCCCAGGAGCAATCCTCAACAACAGGATGACAGTGTGTGGAAAAACAGA
CCTGGTCCTTGGCCCTTAGTGGGACAGTTCTGAGGGGTGTTTCAAAGAGTCTCTGAGGTT
TCCAGGAGGATTTAGCTTCCATGGCCTACAGTGCTTATCCACTCATCCATGAGCTCCTAC
CGACTTTCTTCCTTTCTCTGTTTTACTGTCCTTCTTCTCTTCTAGTGCTTCCCAGGATTG
TCTTCTTAACAACCTGCACCCAAACCCTCATCTCAGGAATGACAAGAACCTGAAGTAGGA
CAAACACAAAGCTGTCAAACGCTACCACCTAGAGAGAGCTGACAGTTTACAGCTTTCATC
CTTTCCATTCTTTCTGTCTGTCTCTCTCTTTACACACACACACCTACAAATATACAAATA
TATACATACATATATATTTAATTTAGAAGTAACCGATTGATATTTTTAATCCATTTTTCT
AAGTGTTTCATGCTGTATGTTATATTTCATTAGTGTTTTTTTTTTAAACTGTAGTATCAC
AGGCATCAGGTTATGAAAATTATGATATGGAGAAGAATTGTTAGCCCTGTGTTTGCTTTT
GTTTAACTTGTGGGCAGAAACTTATAAACAGGTGCAAAAAAACTAAATTCTCTTTGCAAT
GTAGGATTCACTGTTTAGTATGAGTTTTAATACATGTAAGAGGGAATACTATGAAAAAAA
GGAAAAAAGTAGTAAAACCATCTAGTAATTTGTTGGATGTGAGCTAGATTAATTTTTAAG
ATTACCAATCTGCCATTAGTCAGTAGTAGAAAATTAGTCTATTCTAGATGAGTTCTTTCC
AAATTATTTATATATAAATATACATATATATGTTACTGAAAGAGATTTTTGCTACAGGGC
ATGTGCACTCACCAGAGAGTCAGAGACAGAAAGAGAGAAAGTGAGAAATCATCCCCGGGG
GATGGCCATACTGCAGTCCCTTCTCCTCCATTCTCCTCTCAGGATTTTGGGCACGCACAC
ACACAGGCCTAGCATGAGTTTCAAGCTGCTGGGTTTGTGACTTGAACCATGGTTAACCAT
GGAGAGGTCCAGCACCTTAACCACTATGCCACCTGCTGCACCCCCCGCCCCGATAATACA
TCTTTTAACTATGTGTGACTCAACTTTTAGCAAACATATTGAGGATTATTTGAAAGATAT
GCAGTCTACCCCTAGATAATGGAGCTTGCTCTTATTCTCCTATCTAAATCAAGTAAGTGT
ACCACTAAGGGTTGATGTTTCTGGCCTTCCTCCTTCAGTCACAATTACTGTTCCTAAATT
GAGTTTTGGAATGTTACTCACAGGAACACATTGAAATAGCCATTGAAAACTTACCACTGA
ACAGATTGCCAAAAAGCTATTGAGGACACCATGAAACTTCTCTTTTATAAGGACTTGAAG
GACAGAATTCACTTAAACCCCAAAACAAGAAAAAGAAGAGCTACCACTGAGACTTTCTTT
TATCTTCTCTACATTGCCAATGTTGCTCACATTCTCATTTTTGCTTTGTTTCACAGGAAG
TTCGGAGCTTAATTCATGTCCTGCTTTTGGTAATTACCTAAGATCAGGTAAATCACTGAA
TATTCATTTTCTTCTACATTAATCTTGTCTTTGACCTCTCCTTTATTTTTTTCCTTACAC
TTGATTTCTTTTCAAATTTTTAGAAACTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved