Tupaia_belangeri Locus Mono:127:SNORA62
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:127:SNORA62
Tupaia_belangeri
Mono:127:SNORA62
GeneScaffold_3711
SNORA62
1001..1155
2155
ACATTTAAGGATATATATCAAACATATTATATTTAGGGTCTATAACTGATGAAAATGGC
AGCATGTGGAAACGAGAAAAAAAATAAAAGAAATAGGAGTTGTATGTGCTAATACTAAAA
AGATTCAGAAAACAGAGGAGCAGAATTGAACAGACTTTATCCATCTGAGATTCACTGAAG
CATTTGCATACACATATACACACTCACATACACATACAAACACAGAACAACTTAAGTCAC
CATAAGTAGGATGGCATACTGAGTTGAATAATATCTCATGATTGGGGCTAGCAGATGGTC
TAACGGTTAAGGTACTAGACTCACAAATGGTCAACCTTGTTCAAGTCCTGGACCTAGTGG
CTTGAAACTCATGCTGGGTGCATTCACGTGCTTATCTAAAATCCCAAGAGAAGAATGGAG
GAGAAGAGATTGTGGCATGACCATAATGGGGCGGGGGGTACTTCTCACTTTCTCACTCTC
CGTCTGTCTCTATGTCCCTGGTGAGCACATTCATCCTATAGCAAATATTTCTCTTTCTAA
AAAATAGAATATCCTATGAAGAATATAATGTATCCATTAGGGTTACATTTATACTTAATT
TCTGCTCAGGGACCAGCAGTTGGCATAATGATTATGTCAGTGGACTCCCATGTAGTTGAC
CGCGGTTCAAGTCCTGGACTCGGTGACTTAAACTCACGCTGGGCGTGTGTGCATGTCCAA
GGTCCCGAGAGGAGAATGGAGGAGAAGGGATTGTGGCATGGCCATCCCCTCTGTGGTGTG
ATTTCACACTTTCTGTCTCTCTGTCTCTCTGTCTTTCTGGCAAGCACATGTGCCCTATAG
CAAAAATCTCTCCAAAATAAATAAATAAGTAAATAAATAAATAATTTCTGCTCATTTTTA
TTATGGTAAGTTAAAAAATTTAGAAAATTAAAAGAAAATAGAGAGAAAATACAAGTAAAA
TGTATATGTATGTTAGTTCTAAAATTAATAAAATTCTTAGCAGTAGAAATTATTGTGAAG
TTTAGATTTTGTTAAATTATTTTTATTCTTTCCTTAAGTGTAGGTAGTGTGCTACATGAG
GGGCAAGATTTTTTTGCTAATACCACAAGGTCTCTAGCCCAGTTAGTAGAGTTTGATAGT
AATCCTTGCTACAATTAAAAAAAAAAAAAGATAGGGACCAGCAGTTAGCATAATGACTAT
GTCACTGGACTCCCGTGTAGTCGACTGCAGTTCGTGTCCTGGACCCGGTAGCTTAAAACT
CACGCCGGGTGCGTGTGCGTGCGTACCCAAGATCCTGAGAGGAGAATGGAAGAGAAGGAA
TTGCGGTGTGGCCATCCCCCCTGGAGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTCTCT
CTATCTGGCGAACCCACGCTCCCTATAGCAAAAACCTCTCAAAAAAAAAAAAGGGTAAAA
ATTATTTTCATATTTTTATTAAGAATTATTTTATTTAACTTTATTTTTAAAGAGTTATTT
TAACTTTATTTTTATTATTTTCAAATTTGACCAGAGAGAGACACAGAGAGAGGGTAAATA
AGAAAGGAAGCCACCAGGTCTGGGACCTAAACCATGGTTGGCCATGTGGGAGTCTAGCGC
CTTTAACCACAGTGCCACTCACCAGCCCCATTATTTAACTTTATTCATTATTATTATTAT
TTTCCAGTTTTATCAGAGAGAGGGAAAGTGAGAAAGCAAGTCACCAGGTCTGGGACTTGA
ACCACGGTCGGCCATATGGAAGTCCAACAATTTAACCACCATACCACCTCCTGTTCCCTA
TTTCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved