Tupaia_belangeri Locus Mono:109:SNORA74
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:109:SNORA74
Tupaia_belangeri
Mono:109:SNORA74
scaffold_117507
SNORA74
1001..1201
1818
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG
CTTCTTGCTTGAATAAAACCTTGTGTGAGTCAGTCAGTCCTTTGTTAAACCTACACTTAG
GGATCTGGAACAAATAAGAAAGAGAAACTGTTTAGAAATCATCCAGCAGTTGTCAGCTGT
CCAGGCTAGTGTGATGCCTGTGATGGTGTTACACTGTTGGAAGAGTAAGCACTGTCTTTA
TTGAGGTTTGGCTATAAGCACTGTTTTGGTGTGATAGCCAAGAACCTTTGGGCAGTGTTT
TGCACCTCTGAGAGTGGAGTAACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACA
ATTGTTTTGTTAGTAGAAAAGCACCCTTTCTTGGGACCAGTGGATGTTGTAATGATTACA
TCACTGGGCTCCTATGTAGCTGACCATGGTTCGAGTCCCAGACCTGGCGGCTTAAAACTC
ACACTGGGTTTGTGTGCCCAGAATCCTGAGAAAAGAATGGAGAGGGGATTGTCGCGTGGC
CATCTCCCGGGGGTGGGGTTGGGGAGGTGACTTCTCACTGTCTCTCTGTCCTTCCAGTCA
GCACATGTGCCCTGTTTTTTTTTTTTTTAAATAAAAAGAGGGCCCTCTCAATTCTTTACC
TCCTTATATTCTAGATGCCTTCACCTGAATGAGAAACCTGGCAACACCAAGATAAGGAAC
ACCAAGATAAGTAAATGAATGTAGTCCTTTTGTCATGTAGATTTTAATTAAATTATTTCA
GCTCAGAGAAGTAGAAAAGGTACAGTTTTTAAAAATCATGGAGAGGGGGACCAGCAGTCG
GTGTAATGGCTATGTTGCTGGACTCCCATGTAGTCGACCACAGTTTGAGTCCTGGACCCA
GTGGCTTAAACTCATGCCAGGCGTGTTGTTTCCAAGATCCTGAGAGGAGAATGGAGGAGA
ACGGATTGTGGCTAGGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved