Tupaia_belangeri Locus Poly:14:SNORND104
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:14:SNORND104
Tupaia_belangeri
Poly:14:SNORND104
GeneScaffold_1234
SNORA76
1272..1405
2405
CTCTCTGGATTTTAGTACGCATGTACACATGCCAGAGTGTTCAGCACCAGGTCCAGTAC
TCAAACACCAGCCCCATGTGGGAGTCCAGAGCTTTAACCACTACGCCACCTGCTGGCACC
ATTCACCAAATGGATGGTTTCTGCCAAATCACTCACTGCATGAGAACTCTGCCATAAACG
TGACCACCACCAACTACCCTGATCTACCTGACACTTACCAGTAGCCCCCCTTTATCCGTG
GTTTATCTCCCGCAGTTTCGCTTTCCATGATTCGTTATCTGCAGTTCTTTTAAGAAAGTG
AGCAAGAATCACCATATTCACATATCCTTTGTTACAGCATAATATAATTGTTCTACTTTA
TTCTTGTTAATCTTATTGTGCCTAATTTAAAAACTAAACTTTATTATACGTATGTATATA
TAGGAAAACACACACACACAATCTGCAGTTCCAGGCATCCACTGGAGGCTTGGAAAAATC
CCTTGTAGATAAGAGAGTCGCCTATAAACTACAAAAAAAAGGGAACTTTTTTGTTCACTT
TTTGCATCCTCAGCGCCTACCTTAGTTCCTGGCATAGAATATCTCACAAAAGTTAGGTAT
TACTTGTCTCCTGTCGTTTGCTAAGTTTTCTCATGGTCTGTAAAGAGACGCACTTGGAAA
GAAATGCGGAAGGATTTAACAACCGCCTCACTTCCTACCTGTTTGAGTCCCACCTCTATG
GTTGGTACGCGACCACTCTATGCTATGGAGGACTCAGAGAGGTCAGCCAGTTATCAGGCC
GCGTTCTATGCACGTGGTCAGAAGTTTGACTTTCTATTGGTTAAGAGTAGCAAACCCGCC
CACTCACTTCCGGCCTCATCCTTTAAGTAAACGTCCTGCGAAAGTCTCGGTCTTTCCGCG
GCGACTACAGCGCTCTGTAGGTGAGGTATATTAGGCAGTGAGGCCGTATTGGTTGGGTTG
ACCCCGGGGTCTGGGGCGGGTGCGGGGAAACCAGCCAGTCGGCGGTGATGACCTCCCAAA
TGAAAGCACGTGTTAGACTGCTGATGCGGGTGATGCGAACTGAAGTCTGAGCCGAGTGTA
CCTGCGGCCGGGAAGGGATGGGCGGGTGGACGCACACCCTCTCACCCACCGCTGCTGTTC
TTGCAGATCCCGCTTGGCTGAAGACGTCTGATCTCTGCCAGAAGTGTGTCCTCGCCCCTA
ACCCCTACGCCTTCTCACCCCCAATAAAATGGTTTGACTTTATATCGCTGGTGTTGATGT
GTCATGGGTGACGCGCTGCCTTTGAGCCCCCGCCGCGCCTGCGCGTGGCGCCGGGGGCCA
GGCTGCAGCGCCAGAGCACATGCTTGTGCATAACTGGGGCCGTCTGTCCCTAACGCGGGC
GGTCCTTTTAAACGCAAGCTACATGGTGTTGTCCAGGGCTGGCACCTGCCTGCTAGGCTG
GGCCAGGAATTTTGCGGTTTCTTAAGGCCAAGACTCTTAGCCTGAAATGCCCTAGTGGTA
CAACAGGTCGCTGCAGGTTCTACTGCGCAGCAAGTGGCCCAGCGTCCGGGTACATGTTTC
CACGCTGTGGGGGTTGCATAATGTGTCCTTTTGGAGTCGGTGAGCGATGTGCATGCCGTA
TGCAGGTTGAAGAGGTTACCCTTGAGAGACTTTCCGGCTATGTACTTGACAGGACTGGGC
CAGAGTCTGGAGTAGCATGAAACTAAAATGTCATGCTTCGTAGTTAACCATTACTAGCCA
TGCAGATAAGCATGCGACTAAAGCTTTAGGCAAATTTACCTGTATCCCAGTTAGCCTAAG
CTGTTCACTGTTAACAAGGGTAGCTGTGAAGATGGATTCCTATTTTGCTGGTACAGGATA
GGCATGTAACAGCTGGTAAAAGGTCTTTAACCTGGGCTCACATGACACAAGTTCCAGGTT
CTCACATGGTGACAGGGCTGAAGGGCAAGGATGCATCGGGTGGGGAGGGCCTGCTCAGGC
ATTTGGTGATTAAATGGCCTCCAGCTCTGAAGATAGTGGAGCCTGCACTCTTCTACAAGG
GCGGGCTGAAAAGGGCTTGCATCCTTATCCCTGCTCCCGGTTGATACCCGGCTATCGCCA
GAATGTGACCCAACTGGCTCTTTTTCTGTTGCTGTTGACAGGATTGAGTAGAAATAAGAT
GCTTATCTAGTATTTGACATGAAGATATTTATTTTGTGAAACAATGCAAGCGATTGTAAA
TCCCCACATACTATTTGATTAAGTGCAACAGGGTACAGTCGTGTAACCTCTACACAGTAG
TGCATCTAGTCCTTTGCCTTTAGTTATTGCACAAAAATGATAAAGACCAGTGAACAAGAC
ATGCGGACTCTTGACAGGCAGATAGGCCTCCACGAGAAATTAGAACAGTACACCGACTGG
AATGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved