Tupaia_belangeri Locus Mono:131:SNORD74
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:131:SNORD74
Tupaia_belangeri
Mono:131:SNORD74
GeneScaffold_3202
SNORD74
1001..1080
2080
TTTTACCTCACAACAGTTAGAATGGCTATCATCAAAAAAGACAAAAAAAAAAAAAAAGT
CGATAGTATGTAGAGAAAGGGAAATGCTTATACACTGCAGATGGGAATGTAATACAGTCA
TTATGTAAAACAGTATGGAGGTTCCTCAAAAGGCCAAAAATATAACTGCCTAATGACCCA
GTAATCCATTTCTGTGTATATTTCCGAAGGAAAGAAAATAAGTAGGAAGAGACATCTGCA
TTCCCATGTTATTTCAGCCCTATTCACAATAGTCATTATATGGAATCAGCCTAAATGTCA
ATCAATAGATAAATGGATAGAGAAAATTTGGTATATAAACATAATGAAATACTATTTGGC
CATTAAAAGAATAAAATCCTGGGACCTGTGGGTGGCATGGTGGTTGAGACTCCCACGTAG
TCAACTGCGGCTTGAGTCCCAGACCTGGTAGCTTGAAATTCACACTGGATGAATGTGCGT
AAGTGCCCAAAATCCTAAGAGGAGAATTGAAGAGAAGGGATTGCAGGGTGGCCATCCTCG
CAGGGGGAGAATGATTTCTTGCTTTCTGTCTCTGTCTCACCAGTGAGCACAGGTGCCCTA
TGGCAAAAATCTCTCTCAAAAAATGAATAAAACCCTATCATTCAAGGCAAGATGGATGAG
TCTGGAGGACATTATGTTAAATTAAATAAACCAGGCACAGAAAGAGAACTCCCATATGTT
CTCATTCATGTGGAGAAGCTTAAAATAGCGACCTCTTAGGAGAGTAGGGGCCAACCAGGT
GGTATGGTGGTTAAGGCAAATGGATCCCACATGATTGACCATGTGGTTTAAGTCCCAGAC
CCAGCAACTTGAAACACATGCCAGCCTTGTGCGCATGCTCAAACTCCTAAGAGGCGGATG
GAGGAGAAGGGATTGTGGCATGGCCATTCCTACCAGGGAAGTAATTTCTCATTTTCCCTC
TCTGTGTCTTTCTCCGGTGAGCACACAAGCCCAATTTTAAAAAGAAGAACCTCTGATGAA
GCCTGTGGTGGTAGGGACATCTGAGAAAACTGATGAATGCCAATGGCTCTGATGGCAGTA
TGCCAAGTTAGCCAAGTGTGGCTTGGTAGGCTTTGGTTTATCCTCTTAGGGGCGTTAATT
CAGAAAACACCGGTAGTTGGCGGCCAGCGTGGTTCTGCAGTGCACTATTAACATTTGTGG
TGCATCTCCTTGGGTGCACTGCTCTGTTAAAACATGGAGCTCATCATTTACTGTTGCAAA
ATTAATTTTGGTTGGCATAAACTATGTAATTTATACAAAAATATTTCAACTTTCCATGAG
GGGAAAAGTGAATTAAAAATCTGTGTATAATCTTTTCCTTAGGGGAAAAAAAAGAAGAAG
AAAAGAGAGAAAGAGTAGAATAGTGGTTACTAGAGGTGAGAAAAGCTAGGGAGAAGGTGG
ACAGGAGGTGATGGTTAATAGATTACAGAGCCAGCCCCAGCTGTAGTGTCACAAACACAA
CTCTTAGCTCTAATGCCAAGAGCCCTGTCTGAATGGGCTACCGTTGATCTTTCTGACACC
ATCCCCTGACTTCCTTGTCCTTCCTCATCTACACCCGCCCTGGCCTCCTCGTTTCTACCC
AAACACTGTAAGCCAGTGAGCACTTTGGCACATTTGCACTTGCTGTTTTACGCCAGATAC
TCTTTTTCCAATAGACCCCCTTTAACTTTCAAGATTCCTCCAGGACGCCTTTCCTGACTA
CCTTACCTGTAATAGACCTCTTCCTCTGTTTAGGCTCTAGTACATCACGCCTTCAGTTCC
CTTGTAGAATATCTGCAATCTACAGCTGACATTGTCAGTAGCCACCCTCCCCACAATCCT
TCTGATCCTTCATCATGTTCTTAGTGCTGGGAAATGAGCACATCTTCTCCTCCCCTTACA
CCCTTTGAGAACATTCTCACCACGTGGATGAAATAATTCTGAGGCATGTGTATTGAACTA
GTTCTGAGTGTTTCCCTGCAAGACTAAGCCCTATTTGCCTAATCTTGGTATCGCACCCTT
TATTGGTTACCTTCCCTTCCAATATCAATTCCTTATCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved