Tupaia_belangeri Locus Mono:149:SNORD45
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:149:SNORD45
Tupaia_belangeri
Mono:149:SNORD45
GeneScaffold_5807
SNORD45
1001..1079
2079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTCTAATTTCTTAGTGCCTTTCAAAAAGCTGGGGCCGGT
AATGTGTATTATTTTATGTATTTTAAAATTTTGGCTCACATTTTTAAAGGTTATTAGCAA
TTCGATCTCGTGCAGAGACTTAGTAAAATTTTAAATGGGATCAAAAAGAAAATCTCTACG
TTTTTGTCAGTCGTTATGATCTACTTGTCTGCAATGCAGTCTCAATCACAAACGTCCAGG
CTCGTTGATGAATGCGAAAAGTTAAAAGTCGTTGGACCTAGAAGAAAACTTCCTTGGTAA
CTAGACGTAGTTTTGGGGTGCATAAAAGATCCTTAAGAACCTAGATTTGATTAAGTAGGG
ATCTGGCTGCAAATTAAGGGCCTGCAGGATTTTTAAAAATGTTTTTGTTTTTGCATGCCG
TATGCCACGTGTGAACTGTAAGTTGTCCTGAATCCTAAGTTTTGGTAGTTAACTCTTTAA
GTAGGAGATAAGCTGTAACAGATGCAGGTAGTACTTTTTTGGGTCGATGATGAGTTGGCA
TGTATTCTGAATTTAAAGTTGATTATTACTATTTTAGCTCTAGAATTACTCTGAGACCTG
AAAAATAACTGAATTGTGACTAAGAGGGATCTCTAATGTTTTAAAGTTCTTTTTTGTTAT
ATGCTTAAGTACTTCTGTGGCATCTTCTGTTTTACAGTGGTAAACTTGAAATTACTGTCT
TTTTATCTTGTAAGGGCACACAGCAGAAGGATGTTGTTATCAAGGCAGATGCACCAGACA
CTCTGTTATTGGAGAAACATGCTGATTATATTGCATCCTATGGCTCAAAGAAAGATGATT
ATGTATGTATGATTTCTTGTTAGAAGTTTAAATTTTTGTTTTTGTAGTTGGGGTAATGTT
TCAAGGTCAATGATGTGTTGGCATGTATTACCTGAATTTACTCCTGATGTGTAATGAAAC
ATTAGCTCTAGAATTACGCTGAGACTTTGAAAAGTTTTACCCCAAGTTCTTTTTTTGGGG
GGAGAGGGATTTCTTTTTTTTTTTTTTTTTTTTTGCCATAGGGCGTGTGCACTCGCCAGA
CAGAGACAGAAAGCGAGAAGAGAAATCACCCCCCAGAAGGATGGCCACACCACAATCCCT
TCTCCGTTCTCTCAGGTTCTTGGGCACGCTTGCAAACATGCCCAGCGAGAGTTCTAAGCC
ACCGAGTTGAGACAGGAACCTTGGTCGACTAAATGGTAGTCCTGCGACATAGCCGTTAAG
CTAACTGCTAGTCCCTACCCCAAGTTCTTAAAAGAGTAGATTTTGCTCTCTGGGACATCT
TAGCAAAAGTAGTGTCTCAGAACATATCTTTTTCTCTTATCCAAACATTTGGATTATCTT
CATTTTATTACCATTTAGGAAAGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCATGGAGTTCAGGAGATAGGTACTTTTTCCCTGGCAGACTTAAAGGTTTGAC
TACTCCTCATTTTACGTCTTGTCCACCAGCCTCTATTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved