Tupaia_belangeri Locus Mono:190:SNORA16
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:190:SNORA16
Tupaia_belangeri
Mono:190:SNORA16
GeneScaffold_4842
SNORA16
1001..1132
1700
GCTCCAGCCGCAGGCAGGAGCCGAGCCGAGCCGAGCCGAGCCGAGCCGAGCCGAGCCGA
GCCGAGCCGAGCGCAGGGCACTCCAACTCCCAGCGGCACCGCGCGGCCACGTGGGCGCGG
CGGGGAACGCCCGGCCCATATAAGCCCGCTCCCGGAGCCAGCACGGCCTTTCCTGGCGCG
GCATGGCGCGCGTCGTTGTCTGCATCCCGTACTGCGGCATGCAGAGCGCACTGAGCTGCC
GGGCCGGCCCGGCGGGCCTCTGTCTCGGAGGGGCCGCCTCCCTGCGCCGGGCCAGGCTCG
GCTGGTGGCCTGAGGCGGCGGCGTGACGTCGGATGTCCTCGGTCGGATCTGCCGGTGACG
GCCACCTGCTGGTGGCTCCGGGCAGGTTGGAAAGACGAATTTCCAGGACAGACTTTAGAC
CCCTTCGGAAACTCCGCGCCCTGCTCTGTCCCCGTCCCGCGGAGGTGACCCTGGCAGGTG
ACTGGCCCGAGCCCCTCGGGCCGGGGCTGGAGGAGTCGGCAGCCCGGAGGCGCGCCTGCT
CCGGGGACCGGGCAGCGGGGGGCGCGCGGCGCGGCCCTTATCGAAGCTGCAGCTGCTTCC
GCGTAGCCGCTGTGGTCAAAGAGGAGCCCAGAGTGAGTTTCCCCGACAGTCGCCGTCCGG
CCTGCCGTGGCCGGTCTGCAACATTGTGGGGAAAGACAGCCGTGGGCGCGGCCGGGGCGG
CAGGAGGCCGGGGCGCGGGAAGGTCGTTGGGACAACCCTGCTGTGTCTGCCGTGCAGGGG
GACGAGCCCAGTCGCCCCCCACTCTCGCGGGTAGGTCTCCCGCCTACCCTCACCAGGGAG
GAGAAGGGTGGGGCCGGGAGGGGGCGATCGGAAGTAACCTCAGACTCTTTGGGATTCCCA
AGCCTCTTTCCCCCCCGAAACATTAGAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved