Tupaia_belangeri Locus Mono:77:SNORD65
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:77:SNORD65
Tupaia_belangeri
Mono:77:SNORD65
scaffold_130439
SNORD65
1001..1070
2070
TATTTTTAAGACGAAGTTCCGGGGCAGGCAGTGGCATGGTGGTTATGGGTGCTGGATTC
CCACATGGCCGACCACAGTTCAAGTCTTGTACCTAGAGGCTTGCTTTCTCACTTTCCATC
TCTCTCACTCTGTCCCTCTCTCGTCAAATTAAAATTAATTAATTAATTTAATTTAATAGT
TCTTTAAAAACAAAGACAGAGTTCCACCATGGTCCTATCCTCCTGCCTCGGCCTCCTGGT
TGCTAGGGCTACAGGCATACACTACTGCCTGGCCTCTGGGTTGGATCGGAATAGCACCCA
GGCCACCTGTGCGGTCCTAGCCTGCGAAGCAGCAGCATCTTAGCAGTTTGTGCCACCACA
GGGACGTGGCGTAAGTTTTTACTTTATTTTTTAAGTTATTTTATTTAACTTTATTTATTA
TTATTTGTTTAATTTGGCCCAAGAAAGACAGAGAGAGAGAGAGAGGGAAAGTGCGAAGGT
AAGCTGCCAGGCCCAAGACTCGAACCACAGTCACCCACATGAGAGTCCAGCATCCTTAAC
CACCACGCCACCTGCTGGCCCCCAGCATACCTTTTTAAATGCTTAATGACTAGTACACCA
ATGCAGCGACAGAAAGTCATACACGATCAGTTATGTCAAATGTGTCCACAGCGTTTGCCT
GGCAATGCCGGTGAGCACAGATGTGATGGAGCTGTGTATTAAGAAGTGTGTGGAGTGGGA
ACCAGCAGTTAGCATAATGACTATGTCGCTGGACTCCCACGTAGTCGACCGCGGTTCACG
TCCCGGACCCAGTGGCTTAGAACTCACGCCGGGCGCGTGTGTGTGCGTGCCCAAGATCCC
GAGAGGAGAATGGAGGAGAAGGGATTGCAGCGTAACCATCCCCCCCTGGGAGGGTGATTT
CTTGCTTTTCTGTCTCTCTGTCTCTCTCTGTCTGTCTGGTGAGCGCACGCGCCCTATAGT
GAAAACCTCTCAAAAAAAAAAAAAAAAAAAGGAAGTGTGTGGAGTGATGGAATCCCCCAG
AGCTGCCATTACCCACAGATCGTATAGTGGTGAACCTACGGTTTTCTGAAGATGTTGGGG
GGGGGCTACGTAAAGAAATGTGGGGGTTCACGTGACGACACCCACTCACTGACTTGTATT
CAGGCCGACAGAGAACGATGATGAACAGACTTTCAGAGCCAAACTTTGTGCAAGCCTGCA
GTCCCACCCTGAGCGTCTCCCCGACGACAGAGGAGGGGTCCAGGTGAACCTACAGGAGAC
ACTGTTCCAGCAGCTCTGAACCTGACCACAGCAACCCCAGGGTGGGAACAGAGTGACAGG
GGCGAGCCACGCCCAGGATCGGCCTTGTGCCATTGCAGGGTTTGCTTTCCTGCAAAAATA
AGCACTCCGTTCTGCCGCCAGAGCTCTGGCAGGGTGGCGGCCGTGTCTCCAGGATACCTC
GGGGTAGAAGGGCATGTTTCCCACTTCAGTCCAGGAAACATGATGTTTTTTTCCAGATTT
GCCGCCTACAGCAGATATTACTATCTGCCTCAGGAATACAAAGTCATTGTTCAAAATTTT
AAAATAGGATACGTGGTGAAAGCTATATTTGGCCAGAAGTGGGCTGATACCCGCCTACAT
AACCTCTCCTGTGCCAGTTCATGGAGTATAAAGAGAAAACCCAGGGAAGCTCAAGGAACG
TACACACCGAGGGCTCTACGTAACCTGCCCTGAACTCCAATTACTCGTGGGGAAACTGGT
CGGGCCCAGGGTGTCCCTACTATTTAAGACAACATCTTACTTTCTTCTTCCTTTCTGTGT
TAAAACATCCACAGAATGGGGCCAGCAGGTGGCATGGCGGTTAAGGCACTAGATTCCCAC
GTGGGAGTCACACGGGATTACAATCATTTCTAAGAGACCGCATGCTCAGTAAGTATGTTT
TTACTAATTATGAAGGAGGAAAGATGCGCACGTGGAGCCCCACATGTCTTCATCTCCCAG
GTCACTTCTGAATTTCTTCCCAAGATCAGTTTAAGCCCTACCTCTCACAAGAAGCCTTCT
CTCATCTCAGGACAAGCAGTTAGCGTAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved