Tupaia_belangeri Locus Mono:80:SNORD113
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:80:SNORD113
Tupaia_belangeri
Mono:80:SNORD113
scaffold_146325
SNORD113
1001..1072
2072
GTGAATCACAAATTCGAATTCATTCATTCTTCATAAGTTTAGTCTATTAAAGGAAAGAT
TCCCCAAGGTCATGCTTTCATGGGTAGAGGTCAACAGACATGTGTGGCATAGTCATAAGT
TCTTGTTTTTCAAGTGATGGATATATAATCATCATTCAAAGTTAATAGTTACACCAGCAA
AATGAGAAGGTATACCATTTTTGGGGTAAGGAGGGAAATGGAGATTTGAATTAAGTGTAT
GATTAATTGTAGTATGACTCAACAGTGGTCTTTTAAGTCAATCTGAAGGTGTCTATTCAG
TTTTTGAACATTTGAATTTGACTCCTCAGAATGAGACCGTGCGGATTCAGGCATCTCTTC
CTGGGGACTTTGTGGCTCCTACCTTTAGGTAAGCCCTACCCTAGCAGAAAAAATGGCAAT
TACGGGAATTTTTAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCA
TTTAAAATAATTAAAGGTAAATCAAGTTTTAAATTTCAGCCTCACAGTGCACTAGCCACA
TTGTAAGCAATTAATAGCTAAGTGTGGCCTTTGGGGACCATGCTGGACAGGGCAGTGGTA
TAGTTCACATTGCTGCTCATTAGTATTCCTACTGGACAGACCCTCAAGGAGGGAGGAGCA
CAGGAAAGAAGGAAGATTATTCTGTGATGGCTGTGAAGCAAGGACGCTAACAGAGCCATC
CCCACCTCACTGAGGGCCACCACTGGAGGAGAGGTAATCGTTCTTATCCTAAAAGAGCTG
TTCTATGGGAAAAGACCAATAGACAGATCTTTGTTATGCTGAAGGGTATTGTATTTGACT
TTAAAAATTTTTATTTGTTGATTTCATTACTGGTAGCAAACCAGTGAATGAATCAATATA
TGATTGATTAGGTATAAATGAGGAAAAGGAATGCTTTATCCTGGATCAATGATGAGTACC
CTGGGGTGTCTGAATCAAGGATTTTGATTAAACCCTGTAACTCTGAGGTCCATTAAAAAA
GATTCCTCTGTATTATCTCCATGGGAAATAAGCTTATTCCAGGAGGTTCAAAATAATCAG
GATTTTGTTCTTGGGCTTCTGGATATGGATTGTATTATTTTCAGTAAAGCAGTACATGAC
TAAATGAAGAAATATGTAAACAAATGGAGTCATAGGTTATCGCTGGTCCTAAGATGAGAC
TTTGTCACACAGTAAGAAGCATTGCTGATACATTTCTGAAGGACTGAGACCCAGTAAAGC
CAATTGATGGAAGCTGACCTTTTTGGATAAAGAGCTTTTAGGTAGATAGATACGACAGTC
CGTGCTGCTTCTGGTTAGGTTGTTTTGTTTTGTTTTTGTTTTTGTTTGTTTAAGAAAATG
ACAAAATATTTACTTAAATTAGTTGCTGGTTGAATTACTACCTAATTGATAGAGCATTAC
ACGTGGATCTATGAGGAGAATGTGAAGGATCCTTAAAAACTTTGTGGAAAAATGTATATT
AAAAAGAATTATATAAGGATTTCAGAATTTTCTCTCACCAAAATAAAAACTTGTACTTTA
ATTCCATTTTTGCATCGATGTTTTGACATCTCTCATGTGTCAAATGACCAATGAGGATTT
TCACTCTGTTTAAATTTGGTTCCTTAGTTTAATTAAAAATAATGAGAAGAAACGAGATGT
TCTTTCTATGTCTAATGGTCAAATGGACAGGTGTTCATATTGTCCAGTTCTGTGGATTCA
CAGATAGGATGGTGTTGTTATAAATATAAAAAATTAATATCTTAGTGAAGCCCATGTGTT
ATGGAGCAGGGAGAGTGCTTAATCTAGTTCTATGCACCTGCTTTCCAGATACAGAAAAGG
CTCTTAAATTTTGGAATAGTTAGTATTTTTATGTATTTAGCTAGGATTTCCTTTCCTTGC
TTACTGATGTGATTTCTTTAAAATGAAATAGGTAAATGACTTCATTTGTACGTATGTTAT
TCTATATGTAGAACCGTCTGTGTATATGTAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved