Tupaia_belangeri Locus Mono:130:SNORA24
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:130:SNORA24
Tupaia_belangeri
Mono:130:SNORA24
GeneScaffold_2803
SNORA24
1001..1127
2127
GGCCTGATATCATCTGGACCTGAATTCGAAGGGCACAAGATGTCCCCAGTTTAGGAGAT
GAGCATCACGGACCATGAAATCCACTAACGTATAGGAAGAGTCTGCACAGGGCTGGCCCT
GAAGGCAATTCAGAGCTCTGACTTTCATAGGTGGACCAGCAAAGTGTCTTCACCTTCTCC
CTGGTAGCATGTGTTGATGGAACCTGGACAGCCTCCCTGGGCCACAGCTCCAGACCTAAA
AGCATTCCATAGGACCTTGAAGCTGCTGACAGCTACAGGACAGAATATTATTTCCAAGTA
TTCAGGCATGACAAATCACAAAGGTGGGAATGCAGCAAAAGTGAGACAAGCTCCAAAAAG
AGTATGCTCAGTGGACATCTCCCTAAACTCCTACTGAGGGACGTTCACAGCCTCTGCTAA
TCCACTTGCTAGCATACTCTTCCCTGGCCTCTCCCTGGCTGGCTCTGAAGCCAAGTAGTG
GTCTAAATGTCCCTTATCTTCCAGGCTATCGTAAGTTTCTTTTCCCTCTCACCAGCATCC
TGTTCCCTTTATGGTGCTTCCGTTTGTAATTATATATTTGTTTATGTCTTTATTTGCTCA
TTCTCTTTGTCCAATATGTTCCATGGAGGTAGGAACCATTTCTCTTTTATGTCCTTTGCA
CACTAGACACCTAGCAAGTGCCTGGCCTCACAGGTGGTGTTCAAGAAATATTTGTTGAGG
GCTGGCACCATGTCAAGTGGCTAAGGGAGCCAGATTCCACATGGCTAAACATAGTGTTCA
AATCCCAGCTCTGGAAGCTTGAAAAATATGCCATGTACTGTGTGTGCCCAAAATCCAGAC
CAGAGGGAGAAATAGAGGAGAAGGGATTGCGGCATGACCACGTTTTGTTGGGGGAGGGTA
GTGCTTTCCCTCTCTCCCTGTTCCTCTCTGTCTGTCTCTCTCTGGCAAACACACATACCC
TCTGGCAAAAATTTTTAAAAAACAAAAGCAAACAACGTTCTTGCCAGTTCTTCACTGAGG
AGTCAAATCTTCATTCCCTTCCTAGCCCTGGAATAATGTATTCTTGTTTATTGGTAAAGT
TGTCACCATGTAATAGGGATCAGATTCAGACTTGCACGAGTAACATTCCTCACTGTTAAA
AACCTGGAACGTGCTGGACAAACTTTTCTTAACTATTTTTCAAATATTTCCAGGAAGTTG
AACTCATTGCTCTGATGAATGACAGAAAACATAAGATTTCAAGGAATTCAAAGTAATAAT
GGATGAAGTCTTACTCAGCATCCTGCAATAGATAACTAAACTTTTAAATGTTAGCTGGAG
AACTAAATGTTTCAAGTAATGTTTAGGGAACTATCAGGGCACAATTTTTAGTACAGGTCT
GTATTTTTTTTTTTCCAGAGAGATTTTTGCTATAGGACACGTGCGCTCACCACAGAGACA
GAGAGAGAGAAAGTAAAACAAAATCACCCCAACCAGGGGGTGGCCAGCCGCAGTCCCTTC
TTTTCCATTTTCTTCTCAGGATTTTGGGCACACATACATGCACCCAGCATGAATTTTAAT
CCACTGGGTCTGGGACTCAAACCACAGTTGACTAATTGGGAGTCCAGCGACCTAACCATT
ACACCATCTGCTAGTCCCACAGGTCTGATTTTTAAAATTAGTGTTTAAGATGCTCCCCTG
ACATAAATAAATAAAATCCTTGATTCATGAGGCAGGGGGTTGGGAGGGGAGAGAGAGTTA
CACATTCAAAGGCCATTGGTAAGCACACAAAGTAGACATGATGTACACACATATACTATA
AAACTCAGTGTCAAGCCAAACACAAAATCTTCAGTCAGGATGCCAGCCCATAGCACAGCA
GTTAAGTGCTATGCAAAGGAAATTGGATCCCACATGGCCAACCAGGATTTGAGTCCCAGC
TCCAGTCGCTTACATGGTGGGCACAAGTGTGCCCAAGATCCTGATGCAATGGGGAGCTGG
AGGAAATAAGATTGTAGCATAGCCAGGTCCCACAGGCAGATGCTTTCTGTCTGTCTCTCT
CTCGTGCACATATCCTCTGGCATAATTAAAAACAAGGAGGGGCTAGCAGATGGCATAATG
GTTACACTGCTGGACGCCCACATGGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved