Tupaia_belangeri Locus Poly:9:SNORD22
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:9:SNORD22
Tupaia_belangeri
Poly:9:SNORD22
GeneScaffold_3679
SNORD29, SNORD30, SNORD31, SNORD22
1001..1065, 1231..1300, 1532..1599, 1820..1945
2945
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGGGATGGGGACCTCACTGGGAGGCCTGTGAGAGCTGGCTCACCTTAAACAC
TGGACTACAAGGCCTAGCATACTTCGTTGTTTTGGATGCTTCACTAATTATACAATTTTC
TGACTCAGGAACTGCTTTTTTTTTGGTGTGCCACTGAAAAGCCTCCAGAGTTAAGAGGTT
GGTTGATTTTTGTTCTTAAGGCTTATGCCACAAGTAGGCAGTTTCTATGATGAATAGAAC
TAGCTCACTATGACTGAAGATGAAAATACGTGAACACCTGAGAAACTGGGGAAAATGAGG
GAGGGATAACACATTTAAGTAACCTTTCATTCATAAACTGTGTCTTTCCGTAGGTGCTGT
CACCAGTAATCTGCTTTTTGGTCTAAAGGTGAGTGATTTCAGTATGTTCAGTGCCTACAA
TGTTGAGGGGGAAAGTTGCTTGTTTGTAACTATACATGATGACTTCCATGGAATCTCGTT
CGGCTGATTACTTGCTGCTGAGACTAGGAAATCTGATTTTCTGGGAATTAGGTAGGAACA
ACTTTGTATCAGACACAAGTGTTACTGATTTATTTGGTTCTTGTCTGTTTCAGGTCGTGC
GCTTTGTCTGGCCTCTTCAGAGTAATTTGAGGTAATAATCTCTCTAACACTGAGTATCTG
ACTGCTGTGCAGTATCTGCTATGACTGGTTGGTGGCAGTGTAAAGATGTTGCTGTCTTTA
GCCATTTCCAAGTCACCACCTAGGAGTTGCTGCTCACCAGTGATGAGTTGATACCGCCCC
AGTCTGATCACTGTGACTGATAGGTATTTTCTGAGCTGTGAGCTCTCTAATGACAGGCTC
TAACAGTGGGAAGTATGATAGGACTAGCGAGTGGTCTTCATAAAATCTGTTTAGAGTAAA
GTGCATGGGCCTCGCCTTTCCTCCAAGCAACAGAAATGATTGAGATGATCTCTTTTGCAG
GTCACCCAAGCAATGTTTCTCTTCAACTCAAGGCTGAAATCATAGGTGAGAATAAATACA
AGATGAGCTATGCTAAAATTTCCCAATGAGGAAACATTCACAAGTCTTACTTCCTGTCCT
AGTCCCAGAGCCTGTAAAGGTGAACCCACTGGGGCTGGCTGGGGGAGAAGAGGAGAGTTT
GTTCCAGAAGGAACTGTCTGAGGGATGATAAAAATTTCTGTACATGTGAAAGAAATCACT
TCACTTACTAAAGCATTAAAAATTGTTTTGTTTTTAAGGTCTGAGGGAAGAACAAGATGC
AGTATAAACGGTAGGTAAATGTCCCAATAGGTGACGTGGTTAAGGTGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved