Tupaia_belangeri Locus Mono:84:SNORD18
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:84:SNORD18
Tupaia_belangeri
Mono:84:SNORD18
scaffold_71850
SNORD18
1001..1066
1392
ATAAATCTGTTAATCAGAAAAGTCTTCCAATAAGCATAAAATATATAACTTCAAATTGG
GGTTGGCATAATAGCTATGTTGCTGGACTCCCATGTAGTTGAACACGGTTTAAATCCTGG
ACCTGGTGGCTTAAACTCATGCCAGGCATGTGTGCATGCATGCCCAAGATCTCAAGAGGA
GAATGGAGGAGAAGGGATTGCAGTGTGGCCATCCCCCCTGGGGGGTGATTTCTTGCTTTC
TGTCTCTCTGTCTCTCTCTGACTTTCTGGCGAGCTCATGCTCCCTATAGCAAAAACCTCC
CCCCCCCAAAAAAAAATTCAAACTGATATAAAATGATGAGAGCAATTAGTCTGTGTTTCT
GAAACACATGTTATTTGTGGAAATTCCAATTGGGAAAAAAAGGAGGAGAGAAAAAAGGAA
GAAAAGAAAGAAAAAAAAGGAAAGGGAGAAAGGAAGGAAAAAGAAAGAAAAAAAAAGAAA
AAAAATTCCACTTAATGAGAAAGCATTGTGGTGTAGTTTAGTTGGTGGTCATCATTCTTT
CTAAGAGCTACAAAGGCCAAGAGCGTGTCTTAGAATGATTAAAATTCAGATTAAATGAAT
TATACTATGTTGCTGGAATCAGGAAAGTAGACTCCTCCAGAGCAGGACCTGGACAAGGGC
ATTTCTGAATAACTCTGGCACCATGCAGAGTGGCACAGACAGTGGGAACCTCATGCCTGT
GTGCTCTGGGCACGCAAGGGCATAGATACTGCTGAACATTCCCAGCCACTCTGCACACAT
GGCATGGGTTATCTCATTCCATTCTTGTAGTATTTCTGGACACTAATTTTTAGGTGTATC
TTTTTAAAACAGCCTACAAATTAGTGTCTAGAAATACCACATCTCTCAGATTCTCTTTCA
CCTCTCCTTAGGAAACTTTGACTAAAGCTATGTTAGACTTTCTCACTTTATCCTCGTTGT
CTTTTGACTTTTATTCACATTTTCTTTCCTATATCTTTGTGATGCATTTTTGGATAATTT
TCTTTTATCTGTATTCCAGTTTATAAATTCTCTCTTTAGCCATATTAAGTCAGCAGTTAA
AACCACTAATTGACTTGTTCATTTTATTATATTTTTCTTCTTCCTGAAATTATATTCAAT
TCTTTTTCAAATATTCAAGGTCATTTAAATTTTTTTGAATTTTTATTTCTTTACATTCAG
CAATTGTTACTTTATTATGGTCTTTACTTGTTAATTCCTAAAGGTTTTGCATGTCTGTCA
CTGTGTTCTTTTGCCTTTGCTGGTTCTGGCTCATGTCACATTATTTCTTTTTATGATTAA
GTATTTCTAGATGTTATCTGCCCTTTTTCTTTATAGGAATTGTTGTAGGTTAAGACAAAG
TTGCATTCTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved