Tupaia_belangeri Locus Mono:56:SNORA42
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:56:SNORA42
Tupaia_belangeri
Mono:56:SNORA42
scaffold_98725
SNORA42
1001..1112
2112
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCTGACTAGTGAAATAGAATTTTTTGACTTTAGACTAAAACGTTATTGATT
TTCTTCGATGCTTTGATTTCCATATTTAAAGATTTTTATCTTCTCTTGAACTGTTGATAG
GTTCATCTACTTACTATCTGAACTGAATTGTAACCTTTTTTTTTTTAGAGGTTTTTGGCT
ATAGGGCGTATGCTTTCGCCATAAAGAGACAGAGAGACAGAGAGCAAGAAATCACCTGGG
GGGGGGATGGCCACGCCCTAATCCCTTCTCCTCCATTCTCCTCTCGGGATCTTGGGCACG
CACGCACACGTGCCCGGCATGACTTTAAGCCACTGGGTCTGGGACTCAAACCACGGTCGA
CGACGTGGGAGTTCAGTGACATAGCCATTACGCTAACTGCTGGTCCCTCCTGGCTTATAG
CATGTGTTATGGAAAAAAATATATAAGCATTTCTGTTAGAAATCAATGGTACTGTTAAGC
TAAACAAATAGTCTTCCAAAGTAATTATACCAATTTGCATTCCCACCAACAGTGTATCAG
AGTTTTAGTCCTTCAGATCCTTGACAATGCATAGTATTGACTTTTTGGAGAGTTCTTGTA
TATCTTTCATCCTACTTCTCTCAATGGTAATAACTTATGTTAACTACAGTTGTGAAAAAC
AGGAACCTTATGTTGGTATGAACTCAGGTATAGAGCTCACTTGGATTTTACCAGTTTTTG
TTTGGAGTATAGGCCTGTGAAATTTTATTATACACATAGATTCATGTAACCATTATCACA
AGTAGGATACAGAGCTATTCTATCACTACAAAAAAAAAAAAAAAAAGGAAAGAAATTTTC
CTTGTGTTACCCCTCAGTATTCACATGCTCCTCCTAACCCTAAACCCTAGCAACCACTTA
TCTGCCCTCTATCACTATAATTTTGTCACATCAAGAATGCTACATGAATGCTGAGCCTTT
CATTGTGCTCCATGCCAGAGCAAACTGTTGCTCAGAACCACTGTCTGGCCTCTGTGCACA
CAGGCTACGTACGCTGAAGCAGGTAGCATGAAATAAATAAATAAATAAATAAATAAATAA
ATAAATAAATAATGTAAAAAATAAAGAAGAAAGGAAGGAAGGACGGATGGACAAGAATGG
TATATGAATAGAATCATATAGTCTATAGTATTGTGAGATTGGAATTTTCCACTCAGCATA
ATGCCCTTGAGATCCCAAGTTATACCCTGGGTCAATATCAGTAGTTCATTCCTTTTTATT
GCTGAGCAGTAGTCCACATATATATATACCAAAATTTTAAAAATCCAATTCCATGTTAAA
AGTTTCCAGTTTTTAGCTATTACAAATAAAGTTACTATGAACATTTATGAGCAAGTTTTG
ATATGAAAATAGGTTTTCATTTATATGGGATAAATTTCCAAGAGTGCAATTGTATGGTTA
GTCTATGTTTAAGTTGTTTAGTTAAAAAAAAAAAAAAAGGTTTATGGTACGGTGGATAAG
GTGGCTGGATCTCACATGGCCGACTATGCAGTCTGAATCCTGGACCTGGTGGCTTGAAAA
ACACACTCGGCATGCATGTGCCCAAAATTCCAAGAGAAGAATAAAGGAGAAGGGACTGTG
GTGTGGTCACTCCTCCTGGGGAGTGATTTCTCATTTTGCCCCCCAACTTGCACCCCCAGC
AAGTATATGTGTCCTACAGAGGAAAAAAAAAATTAATACTAACAAATTATTTTCCAGAGT
GGCTGTACCATTTCATATTTCCATTAGTAAATCTGGAAAGTAAGCTATAGATCCTGTTTC
TCTGTATCCTTGTCGCCATTTGGTACTATCATTATTTTTTATTTCAGTCATTCTAATAGG
TATGAAGTATTAACTCATGTGGTTTTAAACTACATTTCCCTTATGGCTAGTGACAAACAT
GTTTTTTGTTTTGTTTTGTTTTGTTTTTGCTATAGGGTGCATGTGCTTGCTAGAAAGACA
GAGAGAGATGGAGAGACAGAAAATGAGAAATCACCCCCCAAGGGGGTGGCCACACCACAA
TCCCTTCTGCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved