Tupaia_belangeri Locus Mono:62:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:62:SNORD116
Tupaia_belangeri
Mono:62:SNORD116
scaffold_9992
SNORD116
1001..1094
2094
AGTTAGCGTAATGGCTATGTCGCTGGACTCCCACGTACTTGACCGCGGTTTCGAGTCCC
GGACCCGGTGGGTTAAAACTCACGCCGGGCGCGTGTGCGTGCGTGTCCAAGATCCCGAGA
GGAGAATGGAGGAGAAGGGATTGCGGCGTGACCATCACCCCTGGGGGGTGATTTCTCGCT
TTCTGTCTCTCTGTCTCTCTCTGTCTGTCTGGCGAGCGCATGCACCCTACAGTGAAAATC
TCTCCAAAAAAAAAAAAAAAAAAAAAAAAAGAAGGGAAAAGTCACATCCATTTTTCAAAG
TCCCTGGTGTTCAGGAAGAGGATGTCAGGGCACGAGGTAAGTATACTATGGAAGCTCCTT
GAAGGACAGAGGCACCCACCTTTCCCCCAGGGAGGGAGGCACACAGACATGCAGCAGTCA
TGGACTACCACAGAAACATACATACACAAACACAGAAGCAATCAGACGTGAGTTTTATAG
CTATCCACCAACCTTAGTGGGAACCCATAGTTACTCAGATAATGGAGACAAGTGAGAGAG
TTGAGTGATTTCCTTGGGCAACAGTGGCTTGCACATGTTGTGTTGTTTACCTAGTACTTT
TTCTTAATTAATTGCCTATATGATTTCTCTGTCCAACTCAGGTGAAGATGCCATGATAGC
TTTGCTGTGCACACTGAAGGAAGGCTCCATTTTCTGGGAGGACCAGAGGCCTTGGGCGGA
TAAGTATGGCCTGGGACACACCCACTATATTTGATCACTCTTGATGGTAAGCATTTCCAG
GGCCATGGTGCCAATTATGTCTGATGAGTATCAAGGACTGAAAGGACCTAGATGTCCATA
GGCCATTAGTAACTTGCTGAGTTACACTCAATCGCCCTGTATATCCATGGTACTCCACAA
CTAGTCTCTGGAGTATCCAGGGTGCTAAGTCTTAGAGGTCATTGGCCCACCGAGTGTACC
TTGCCAGCAGTGCTCAACTTTCACTAGCTTTGAATATGCTTGGATTGATGATGACTTCAC
CATAAACATTCCTTGGAAAAGCTGAACAAAACGAGTGAAAACTCATTACCGTTGCTCTCA
TTGAAACTGAGGTCCAGCTCAATACGTCCAGCCAGTGTATAGGATTGAGAGTCATCTTCC
ACTGGTATGCATATTCATTCCACCACCAGGGGAGCTGAGCTACACCATGCTTCTTCTGGA
CCATCAGAACACATCCTCATTGAGATGTGCCTGGGCAGAAGAGTCTTTGGTTATTCTTTC
TCAGTGGTGTGGCAGCCGTGTAGACAGGCATCTTGATTCATAAGCACAGGGAGTATGCAG
GTTTGTCCTGAACTTGGTGAGCTCCTACCATATATCTCTGTTGTCATTATGGACCTTCAG
AGGTAGACCCACATGGTATATGTCTCGAAAACCGGTGCCTCCATTCCTTGGCAAGGACAT
AGGGCTTGGCTGTTAGCCAGATCTTATACTTGCTGCTGAGTCTGGTGCAGAGAGTCAAGT
GCCAGTGTAAATAAGATAGAATAAATAGGCAACAAGGACATAGCTGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved