Tupaia_belangeri Locus Mono:187:SNORA2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:187:SNORA2
Tupaia_belangeri
Mono:187:SNORA2
GeneScaffold_3612
SNORA2
1001..1137
2137
GCTAGTGCGGTGGTAGGCCCTCAACCCTGGCCATAACTTAGATTCACCTGTGGAGCATT
TAACATGTATTGACCGCCGGGCCCACCCCTGACATGCCGATCCCAGTTGTTTCAGGCAGG
GCATGTGCGTGAGTGCGTGTACTCTCCAGTGGGGTCTGGCTAAGGGCATAAGGGATGCTC
TAGGGAGAAGGGAGACATAGGTTCTCACTGCTGGGATCTGTGAGTCTGTGTATTCAAGCC
CACGGGGTGAAGGACAGTGAGAGCTCAAATGAGCTCCGTGTGACTGACCTATGCTTGGGG
AGAGAAGAACCAGCCTGTAAAGGAAAAGAGCAAGTAAATAAATGGGTGGCAGGCACTGGG
GGACCTTTACAAAGCCATGCTGCTTGGCAGTTAGCTGGAAAGTTCTATTACTCCTCTCTG
CTTTCTCCTCAGCTCCGATTTTTAGCTCTATCTCCACTAACTGTCCTGTAGCAGAGAGGA
CCCCCTGCTTCTAGAGTTATCAGGCTGAATGTCTCTACCTCTGCCTCTAGGTCACACTTT
GACTTGGATACTGCTTTCGGAGTCTCCACCCTGGGTTTGCTCCTGCCACATTGGCATGTA
GTGGCCCACTAGGCGGGAGCAGGGAAGGGACGCACATTTAACCGAGCCATAGGCGAGAAA
GGCTGGGTGAAGGTCAGGGTATCTCTAGTCTTAAATAAAAAAAGGAAGGATATCTCTAGT
CTTCCCACGAAGTTAAGTCCCTCCTGATGAAAATAACTCGCACCTGGGAATCTTTGGCAT
GTGAGCTTTTCCCCAGCAAATGATCGGCTGTCCTTGGTTTGTCTCTGCAGGAAGGTATAT
ATATGCCCACACCTATGCTTGTGGGAGTTTGGAGCTGGGTAATCTATGACCAGTGATGTA
ATAATCACAACATAGCATGATGAGCAGTATGCGCGGACCCAGGCATGTGTGAGCTGTATC
TACGGCCTAAGTTTGCCCTCATGATAATTCCACCCTGTGCTTCGGCCCTGATTCAAGGCC
AGCAGTTTGCTGAAGATGTCGGTTTCAAGCAGGAGCCTAAAAAAGAGTATTCTTATGGTC
TGTTGGTCATTTCAGGACTTTGGAAATGTAATGGCCTATTCGTGAGGAAGAAACATTTAA
GTTACTTGGTGATAGTTGGGGCTAATACTTTATAATTATAGTACTAGGATGCCAAAATAG
CCATAAAATATTTATATTTCTCACTAAAAAAAAATTCCTCCCTGTGCGTGCTCCACTTCC
TCCTTGGTTAGACTTCAGAGCCATATTCCTGAGTTTCCCAGAATTCTCTCTTCCCTGGTA
CCAGGAGTTTTTGGCAGTCAGCTACTTGCTTCAAAGGACTGAGCAGCAGTACCCATGTTC
CAACACAGTTTTTTGACAAAACACCCCTTTAGTCCTCAAAGAAATGGAGGGAAGCAAGGG
ATGCCTAAGCCGGGGTTGGGAACTCACATGGGGTGGTGGTGGGAAAAAATCAGGGGACAG
TTTTAATAATCATTGTTTCTCTGGTTGGAAAAAACCAGGGGAAGAGCAGGGTCCCCTACA
TAATGCAGCCTGCTACCACCATCTAGTGGACAACAGGAGGAAGTGACGCTCTGGAAACAT
GGAATTTCAGAAACCGGCCATTTCAAACATTTAGTAACTATCAGGTGGCCTGCAGCAGTT
TCCACGGCGACTTTTGTCCCTGCCTCTCAACAGAATTATGTCCTTTTCTTTTTCCTTCCC
ATCAATGTCCAGCACAGGTTTGTTCCCAAGGCCTCCCTGACACTGATGACCGACTAGTTA
TAAAAATAAGTTTGGAACCAAGACTTGGCTCTGCATCCCTCAGGTTCCTCAGTGTAAAAC
GCACACCTTCAAGGCCCCTCCCACTCTGACTTAGAACTCAGCGGCTCTGCAATCGGAGTG
CTTGTTCAGACAGACTGTTGTCCCCACACCCGCCCTGCGCTGTGCCTCTGACCCAGGAGG
CCTGCAGTGGAGTCTGAGCTCTTGCCTTTCTAATGCGTTCTCAGAGCTGATGCTGCTAAG
CCGGAGCCCACCTCGGACTCCTTGGAGAATCCCTGTTTTGAGTGGTTCAGTTTCCCCGAT
GTGAGAAAAAAGGGGTGAACAAGCCTGTGGAGGAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved