Tupaia_belangeri Locus Mono:214:SNORA66
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:214:SNORA66
Tupaia_belangeri
Mono:214:SNORA66
GeneScaffold_6094
SNORA66
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAAAACAAAGAAAAGGCT
ACGGGCCAGCTGTGGCACGGCGGTGAAGGTTGGAAGACTCCACTCCACAAGGCTGTGTGA
CCTGCATGCTGGCCCCAGCAGCTTGAACAAAACACTGGGCATGTGTGTGCCCAAAATCCC
CAAAGGAGCAATGGAAGCAAAAGGATCCAGAAGGTTGCTTGCTTTTTCTTTTTGGAGAGG
TTTTTTCTGTAGGGCACATGCACTGACCAGAGAGGCAGAGACATAGAGACAGGAACGAGA
AATCACCCCCCCCCAGGGGGGGGATGGCTATGCCGCAATCTCTTCTCCTCCATTCTCCTC
TCGGGATTTTGGGAATGCATGCACACGCGCCCGGTGTGAGTTTAAGCCATTGGGTCCGGG
ACTCGAACTGCGGTCGACTATGTGGGAGTCCAGCAACACAGCCATTACACTAACTGCTGG
TCCCCCCAAGGGTTGCTTTCTTATTCTCTCCCTCTCCCCCAAACCTTTCTGTTCATCCAG
TGAGTGCATGTGCCCTATAGTAAAATTACAAAGAAAAAAAAAAGGTTTTAGGACAGCCGG
TGGTGTGGTGGTTAAGGCACTGAGATCCCACATAGCTGACTACACAGCAGTTTGAGCCCC
AGACCCGGGTCTGAAAAACACACGTGCCCAGAATTCCAAAACGAGGGCAAAATGGAAGAG
AAGGGATCCGCAGTGTGACCATTCCCCATGGTGGGAAGTGGGGAGTTGCTCTCTTCCTTT
CATTTTCTCTCCCCATCAAGTATTCACACCCTCTAGCAAATTAGAAAAGAAAAGGTTAAG
TCTGGCAAGATGATGTGCCTGACCATACAACATTCCAACCAGAGGAGGTAGAAAGATTAT
CACAGGGAGGGTGGAGAGGTTTACTAAAGAAATGGAAGAAAGTGCAAACTCGATCACTAG
CTCTGCGAGATGTGGCGGACGCTAAGGGACCAGGCTTGCTAAAGTAATTTTGGTGATAGA
AATATGTAGTTAGCCTCAAGCTATTGAGGTGGCCCGTTCTATCCTGTACAGTATATACAT
ACCAATTACTGCCTTTTTTCTTAGGGTTCCCCAAAGAAAAGTGTTCTTTTAATCTTTACT
TTTTTGATCTTTATTTGAAATAATAAAATAATACTTTAACAAGCACTTAAGCATTGTACT
AACACGGTTTTTACTGGATTTTGGACCCTGAATTTATAGGATAGCATCATAAGAGTTGGG
GTCTGGGAAAGTTGACTTTAAAATCTTATGTAAATACATGTATTAAGGCTTAGATTGATT
AAGCCTCCATCTCATTACAAAGTATGTCTTTTTTTTAATTGAAATTAAGTATTTTTGTCC
TTTTTGGCTTTTGTTCCAAAATTCTTTATTTTGTAGAAAAAAGGAAATAGAAAAAATAAG
CTCAGGTCTCATAGGCAGGTACTAAGTTTCTAATACTGGAAAAGAGCAACGGTAAGTAAA
CTCTGGAGGGAGTTTCCACGTTATTTTTTCATCCATATATCTATATGGGACAGCAAGAAA
CCAATCGATTTTTATAATATCAAGTTAAATCAATGATTATAGAAAAACTACATTTTTTTC
TTAAATAAGGTTTTAGAATAATTTTATGTGTAGTTAAATGAAAAAACATTTTTTAAAGAC
TTATTTAACTTTAATTTTTTGAGAGGTTTTTGCCATAGGGCGAGTGCACTCGCCAGAAAG
GTAGAGAGAACCAGAAAGAAAGGGAGAAATCACACCCCAGGGGGGATGGCCACACCACAA
TCCTTTCTCCTCCTTTCTCCTCTCAAGATCTAGGGCATGCACACACATGCGCTGAGTGTG
AGTTTAAGCCACCAGGTCCGGGACTCAAACCACAGTTGATTAATGGGAGTCCAGCAATAT
AGCCATTACACCAACTGCTGGTCCCTATTTATTTATTTATTTTAATTTGACCAGACAGGG
ACAGAGTGAGAGGGAAGGAAGGAGGAAAAGTGAGAAAGCAAGATGCCAGGTCCAGGATTC
GAACTGCAATCAGCTATGTGGGAGTCCAGCACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved