Tupaia_belangeri Locus Mono:103:SNORA62
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:103:SNORA62
Tupaia_belangeri
Mono:103:SNORA62
scaffold_136861
SNORA62
1001..1159
1983
TTTCATATTTAAGCTTGGGTCCCCTCCTCAAGGTAACTCATTATATATATTCAAATATT
CCAAAATCAGGAGCATCACATTCTTGTCCCAAACAACTCAGATAAGGGATAATTAAACTG
TCTTATTGTTGATAGATAGATGATAGATAGATAGATAGAAAGATAGAGAGATTTATATAT
ATATACATATATACATATACATATATATGTAGATAACTTTTCAGATACACATTTTCAATT
TTGACTGATCTTTTCTTTTTAGTAATACTCTCAAAAATATATAGGTATATTTTAATTTTT
GTAAAATTTAACTTCCTGATTTTGAGTTTTATACTTTGTGAGTTTTGTGTCTTATGTAAA
AATAGTATTTACTAAACCTAAGTTGAAAGTATTTCCTTCTATGTTTTTATCGACTTAGAT
CTACGATAGACTTTGACTTACTAATTTTTATTTAGTATTGAGATATTTATTAAGAATCTG
GTTTTTTAATCGATATAAAATTAAAATGACTTTTTTGCAAAAACACTTCTATTTCTATTG
AACTCTCTTTATATTGGCTGAAAATCAATTGACTGCTTGTGAGTGGGTTTATTTCTATTC
CACTTCTTGGATCAACGTGTAGGTGCTTTTGCCAATATCACAGTCTGGATAAATACATCG
AATGAGCACTAAGACATTTTATAATGCTTTTAACTGTTGTAATGTCTTTCTTTCCTTTTT
TTTTTTTTGCACTTTTTAAAATCTTTTTTCTTGATGTATTTTACCAAAAAAGGATTGCTG
AAATATTTTTCTATAAATTTTATGCAATAATATGCACATATTTTGAAAATACAGGTTGAT
AAGTTTGGCATATTTATAAACATATGCCTCACTACAAGTTTTTTGGTGTCTAATGCATCT
CTGTAATCCACTCCTCTCTCTCGCCTTCTGATCCCAGGCAACCGCAGGTCTACCTCTGTT
ACAGTAGATTGGATTTGACTTTCTAGAATTTTATATAATTCGGTTCACATCGTTAGAGCT
TGGAGTTGAGGCCACTGACTGGCTGATGAGCTCTCAAGTGTAGGTAGAGTGCTACATGAG
GAGTGGAGCAAGATTTTTGCTACCACCACAAGGATCTCTGGCCTGATGAGTGGAGTTTGA
TAGTAATCCTTGCTACAAGTTAATAGACAAAAAATAATTTTGTATAAATAGAATTGGATA
CAATTCATTTTTAAATATTTTTAATTAAAAACAACATATTTTTTAAATTTTTTTCTTTCA
GATTGTATTAATAGCTTATTCTTTTTCTTTGCTTAAATACTTCATTGAATAGATAATTCA
AAATTATTTAGGTTATTTCTTGGTTTCTATACAGATATAGAAGCAATGAACTATGTATTT
AAATGAACATATGCATTTATTTTTCTTGATAAATACTGTAATATCTCTGTAATTTGGTAA
GGAAGTGTTTAAATAACTATGTCACTCTGAAATTGTTTTCTGAAGTGTCTTTGCATTTAT
ACACACAGTAGACAAGGGTTTAAAATGCTTAGTATCATCACCAGCAGTCAGTACAATCAT
TTTGCATTTTTACCATTCTTAAGGATATGCAACAGTTTGTTGTGTTTTACTTTTCATCTC
TAAACAATAATTGCATTGAACAGTTTTTCAGATGATTACTTGGCATTTGTATGATTTCTT
CTGTTCCTTTTTAAAATAAGGTTTTGTGACTTCTTATTGAGATATAAAAATGTATATTCT
AGATATAAGAATCAAGTACATATATATTTTGCAAATAGTTATCATACTAAGTGAGTACAT
TTTTAAGTCTAAATATAAGATATATAAAACTTCATTTCATGCAAATGAAAGTAGAGGATT
TATTATTAGTAGATATGGAATATTACTAAGAAAATTCCTGTGACAGAAAATATATGATAA
ATATTGAAACTTAGACATTTATAAAGATATTCTTAGGATGGAACCATCAGATAGTAAAAT
GGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved