Tetraodon_nigroviridis Locus Poly:SNORD99
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD99
Tetraodon_nigroviridis
Poly:SNORD99
Un
snopsi28S-3327, SNORD103, SNORA44, SNORD99
1308..1445, 1564..1636, 1758..1886, 2001..2072
3072
CAAAGCCGTGGCCGCGGCGTGTCTCCGCCGCCTCCTGCTGCTCCTGCGGCTCCTGCTGC
TCCTGCGGTCACGTGACGCCTCACCTCCGCTCCCACCAAATCTGCCTCCACAGTCAAAGG
CGCGATTGTGTAACACAGTCAGACGTCAGCCGGTGGTTTCTGCGGCTCAGCTGCGGCGGG
TTGGGACGTATTACTGCAAGATTCCTCCGGAAAAAGGCAGGGAGGGAGCCGAGTCTCGCC
TGAAATGAATCAAAAAGGGGGATTATTCCGAGATGGAGCGTCGTGTGTGTTGACTGCCGC
AGGTCGGGCTGCTGTCCCTGGTTCTGAAGTCCTCCCGTCTGCCACTTTTTCAAAGTACGT
CGGTCTTTCAGCGATATTGCAGCTTATTAGTTCAAACTATAAGGCGGGAAAATGTTACAG
TTGGTTTTTGTGGTCGTATTTGTGCGCCAAAGTAACAATAAATCTAGAAATGGGAGCGTT
TCTTAAAAAATGTATAAACGTCATATCCCATCGTGCATCCGGTGCACACGTGACTTCCAG
GGACCAATCAACAGCGGGCTGGGCTGCCCGAGCGTATAAAAGGCCACGAGCCCGACTTCC
TGCCTCTTTCTTCTTCGGTCTCCATGAGGCAGAAATGCGGGAGCAACTCTGCTTTTTGGT
GAGGCTTTAAACTGGCTTTTTCCACTTTTATACGTTAGCGTTTATTAAGTTAGGAACGTT
TGCTTTCGTACAAATGAATATTCGGGTCATTCCAACTGGATACATCAAACACGTTCAATA
GCTAGCTTTAGCACATGTAGCAGTAGTAGGCCTTCAAGCTCCAGCGCTTTAACTCTTTAA
AACCAACTTCTGAAAACTCCAGGCGCTGTTGCTTTAGTTTTGCCATCACCCCAAATATCT
TAATCCCTTTATCAGCGTTTGTTCTTTGATCTTTTCACGAACCACGTGGTCTGTCTGCCT
AACCTTCGTGGTTTTGCACATTAAACAGCAAATCTAATGACATCAGTGAAGACAGATGGG
ATGTGTTGGGAAGAAAGTGCACGTTTATTTACGAGGCTTGACTTACCATAGCCTTCTTCT
TCTTCCCTGCAGTTGGAACTCTCCTCTGAAAGGTCGGAGACCTGAGTCCTCCATGTCTCG
GCGGCTTCTTCCGCCCCTAAAGGTGTTCCCATCTTCCAGCGGTGGGTCATGAGCTCAGAC
GGGTGGTGCCTGCACCTGGGGGTCTCCCAGGGTCACCCTGAGCCCCCGGTCCTGGTCCCG
GTCCTGGAGGCCTGAAGCAGGTGAGCCACCCTCTGTTTCCGGCTCCTCCGACAGGCTCCG
ATCGAAGCCGTTCGTGCTCCCTGTAGCAGCGAACGGTCAAACGGAAGCCGAGACCAACAC
TTTCACCGACGGTCGCTGTTCAGTTTTAAAGTAACTGCTTCAGCAACATCTAGGGGAAGG
ACACCTTGAAGCATTCAGATGAACGTGTCCTTTGGTTCTAACCGGGTCTCCTCCGCAGGT
GAAGCTGAACCTGGCGGGGCGGCTGAGCAGCAGGTGAGTGCGTCTCCGTCCTCCGTGCTG
GCGCTGTGGCTGTGATGACACACTTGCCCTCACTGAGGTCAGGCCTGACTGAGACTCTTG
TACTCTCCTGAGCCACATTCCTGCTCTCGCCAGTGTTCGGTGGTGCAGGAATGGGGTTTT
AAAGAGCGTTTGCTTGCAGGGGCGGCCTGGAGGACTGGACGCTGGAGCCCAGCTGAGGTA
ACGGCGGCGCCGGAGGCGAGGCACGCTATCCTAAGGGCCCGGGCTTGTCTGTAGTTCTGG
GTTCTCCAAGTGCGTGCGAGAACACGGGGCCAGTCTTTGACTGCGGCGGCCTCATGCCAC
CAGCAGCCACTCAGCTGTCCTACAGTTGCTGCCGCCGCCCGTTAAGCCGACGCCCACTAA
CGAGCCGTCTCTCAGCAGGAGGCCGGGACCACCTCCACCCGTCCTGTGTAAGTCCAACAG
GTTTTTGCTGGTGCTTGACCCTCTGATCTGTGATGATGCCTAAATGATGAGGACTGCTGG
ATGAAGCTTGCGGATATGGGACTGAGATCAGCCGCTGGCGCTCCTCTCCACCAGCCGCGC
CGGCATCCTGCTGACCCCGCTATCGTTCTCTTCCAGGGGGGGAGAGCGGAAGGCTGGAGC
CTGACCTGGTCCTGGACTGAACACGTGACTTCATTAAAGCTGAACGTTCAAATAAAAGCA
ACCTGACTTTGGTCTCTTTTCTTTCCGACACGTGCCTGAAGCTGCCCGGTCACACTTTTA
TTTGCCTTTAGGAGTTTAAAGCAGGTATATTTACAATAAGGCCACAGCAGGTGGTCAGTC
TGGGGGGTGACTGGTTCCAGGAGGACCAGTGGGTCTCCAGCCCTGCGTCCAGGGCTGAGC
GCCAGCGTTGCTGGTCTGACGCTGGTGTGACGCTCCTCACTCGCTGGAGATGGACGGTAA
CTTGAGCTCCGAGATCTCAGAGTCGGGGGTGCTGCTGCCGCTGTGGTCGCTGTAGGTGTC
CCTGGGGGGACAAAACAAAGTCTGAGGAGCTGCTGGGACCTGCACCCAGCAGGGCGCGGC
GGCGGGGTTACCGTGGAGACAGCCGGCAGCCCTTCTGCAGGTAGCTCTGCAGCTTGCCGG
CCGAGGCCAGCAGCAGGCCGAGGTAGGGAGGCGACGGCTTGATGGGGCGGGAGGTGAACT
CAGGGTGGTACTGCACACCCACGAAGTAGGGGTGCTCTGAGGAGGAGGAGGGGCCACAGG
TGAGCAGACGGGCGGCGGCCATGGCAGCACTGGCTCACGCCCCCCTCCCTACCGTCCAGC
TCGATGACCTCCATCCTCTCGCCCTCGATGTCCTGACCCACGAAGCGGAAGCCTTTGTCT
TCAAAGTGACTCTTGAGTTCTGGGTTGACCTGAGCAGAGGAGCGTCCAGAGGTCACCGCG
GGCGCGCCCTCGCTCCGGCGGCAGCGGCGGCGGGACCGCACCTACCTCGAAGCGATGCCT
GTGCCGCTCCTCCACGTACTCCGCGTCCCCGTAGAGTTTGCCTACAGAACAGACGGTCAG
CGGCTGACCCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved