Tetraodon_nigroviridis Locus RPS20
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis RPS20
Tetraodon_nigroviridis
RPS20
Un
snoU54
1907..1973
3614
GAGTTAGCGGGGACGCCGAAATTCATGTCTTCCTCAGCGTCTCTTCTCAGCTCCGAAAA
ACGACGAGAACTTTTCCTCTGTCAGTCTGCGTTTGGGAACCATGACGCACAGTAGCATAA
GCCTGAGGTGCAAGTATTTTCTTTGTCTTCTCCTCTTCCTCAAACTCTGCAGCCTTTACA
GCCTTTACTCGCAGCGGATGACAGTCGTCAAACTTTAGGTGTAATTAACTGACAACAAAA
CAACTTCGCTCCAGGCTACCGGTTCAGCCCCGGTTCCGTTACTTCTGCGGGATTCCAGAG
AGTACAGTCAAGTAGTATACATGACCGCCATACTGGTTTCCGGTCTTTTTCAAAATAAAA
AAAATTGCGTCTTCCACGTATAATGCTGTCCTCCACTCATTTCAAAAACAGAAACACTCC
CACAGTTTCACCAGACCTGGTGTTCCAAAAAGAAAATTGAAAAGTCCAGATTAACACAAA
ATCTTTTCTCGGATCTTCCAGTTTAACTTAGCAAAAAAATTATAATTATCCATATATTAT
ATTCTCCTTTGATATATTTGAACGTCTCGCAAACAGGTGTCTGTGTGCCTAAAACTACAA
ATCCCCTTTTTTTTTGACGACGGTTTTTTTATTTTAAAAAAAAAACGGATATGATTTTTT
GTAAAACGGTTAACTTGATAACAAAAATGTGTTCTTTACTGCCATCGTGTGGCCACAAAT
ACGAACCGCAGCATTCCAGCGCTGCCAGATGTGCGTTACTTAAATGCTTTTAAAGAAGCT
AATATTTAGCATTCTCCGTTAGTGTTACGCCAGAACAACCCCTAGGTAAATTTTAAAAGT
AACTTTACACTTCTCAGCCGCTACTGGATGCTCGGGTGGCTAAGAAGTATTATGTTATAA
ATGTTATCTGGCAGTGCACTTCTCAGTCACCATAGGGTGGCGCTGTCGGTAAAAATGACC
TAGAACCAACGAATAAGAACTGGAAGTCCCGGATGTGGGGTACATAATGCGGAAGTAGGC
CGCTGCTCGCTCTTTCTTGTGAAGTTGACCACGTTGGTGGGGTCCATTCCTGGCTCACCG
CTGTTCGCTTGGATTTCTTCCGAATAAGTCGGTCAGGAATATTCACAATGGTATGATTAG
GTTTACTATAATCACCCGCATTCTAATGATGTCAGTTTGCTTCGTGTGTTTGTTTTTGGC
GTCTACTAGAACGCTAGTTTTCGTGGAGTGCATGCTAATGTCGATAGCTTCGGTCTGTAT
AAAAAGCTGTCCCGCCACAATTCCTCCCAAAACGATTATAAATTCGTCTGTACACACAAA
AAACAACACCAATCGATCTACGAAGATTTTGCGATGTATTTTAACCTTTTGTGAGGTGAC
ATGCCTGACTTAGAGCATCGTGTCGGTTGAAACGAGCACATTTATCAGGTCAATGCGGTT
TATGTTAGCCTCGATTTCTAATGTCTTCATAAAAAAGTGTTCCAACTTTTTAGTTTATTT
TAGCAACCTGCAATGAAATTAGCTGCAGTTTAGACTTTAATCACAGTTGTTTGCATTAAA
ATAAACTGAAGGAATGGATCCCTTGTGTTAACATGTCAGCAATTGTGGTGTTGGATGTGA
ACCAACTTTTAAGCAACTAAAACGTCTGAAATCATCCAGATTTGGGGGGTCAAATCCCTT
ACAACCAGTAATAAAGTGTCAGGCACCTGCCCTTGAAACAGCAGTCCTACTTGTGGGATT
TGTCATTGAGTTTTTGTTTTGCCCATCAGGCTTTCAAAGACACCGGGAAGGCACCCGTGG
AGACGGAGGTGGCCATTCACCGCATCCGCATCACCCTCACCAGCCGCAACGTCAAGTCTC
TGGAGAAAGGTGAGTCGCAGCTGCAGGGTTGAGATGACGTGAACACCTGAGCTATGAGGA
CAAACATTTGAACAGATGCACTCTGGTGACTGTATACGCTATTCTGAGCCACAGCTTCTT
ACAGCTGGGACCGGAAATGTGACGGCACTCTGTGTGTGTGTGTGTAAACTTTGGTTTTTC
ATCCACAGTCTGTGCTGACTTAATCCGAGGGGCCAAAGAGAAGAACCTGAAGGTGAAGGG
ACCGGTCCGCATGCCAACAAAGGTTTGTTGTGAGGTTTTTTTTTAAATAAAGACACTTTA
TATACAGTTAAGGCCTTAAGATTCCTGCCTTCAGGGTTATTTATGTCATCAATGCAAGAG
AACTTTAATTTGAAACTCAGGAGCCTTAACTTTGTAGAGTTTTCTTTATATCCCAGCAGT
GGTGTAGAAATATTTGCCAGGGAGAAAATTGAGCTGGAGGCAGACTAGTTATGAGCATTT
TTTGTTGGCGTTCTCTTTTGCCCCTGGCTGAAGTTTGATGTCTTGCTCTTGTGCAGACTC
TGCGCATCACCACCAGAAAAACCCCCTGTGGCGAAGGATCCAAAACCTGGGATCGCTTTC
AGATGAGGATCCACAAGCGTCTGATCGATCTGCACAGCCCGTCGGAGATCGTCAAGCAGA
TCACCTCCATCAGCATTGAGCCTGGGGTGGAGGTGGAGGTGACCATCGCAGATGCATAAA
TGTTGCCTCTGAATAAAGAGCAGAATGAAAACTGGTGTCTCCTGTTGTGGATCGGTTTAT
AAAGGTTTCTATGATGGTACATCAAGAAATTGACACATTTGGGCCCCAGTTTTATGATTT
TATATCAACAGAAGCTGTTAAATTTTACCACAAATTGTTAAATCCTCTGAGACAACCAGC
GGCTAAACCAGGTTCTTTTGGCCTTAAGCTGCAAAGTTAATATTTAATTAAGTTGTAACG
TCTATTTGAACTCTGAAATATGAGAGGGGAAAAGAATGTGAGCGTTGATAAATTGCCTAA
TTCTGCCTTAAGGTGCTGATTTTTGCTTAAGATCTATAATATGTTATAACAGCTGGTAGC
CCAGATATTTACTTGATGGGTGTCTGAGCTCTGACGTTCAGATATAAATATCAGCACACC
TGGTTTATTAAATAAAGTAAATGAGCTTCATCTTTAGTTTTAAACATGGCTCATATGCAA
CATTAACTCAACCCAAAGCGCTTTAGATGATTTAATCTGCAGTTAAAGCCTGAGATTGGT
CGTCTGGTGTTTCTGCGCACACCTGGTTGCAATCAGATTTGATTGTCACATGGAGGTGAA
GCACCTGGTCCTGGAGGCCTGGAAAAAGATCACTGTCCACTGAATTAGACGACCAGACCT
GGCTGGAGGACGTATGGCTTCACAACAGGCTGCACACTTGGTGAAACTGGCATCAGCTGC
CGGTGGCTCCATCAGGATGGAGAATGAGGTTTTCTGTTGCTTCTTTCCAGACTTCTTTTT
TTTCTTCTCCAAGTTGTTCATACCGGATAACGGGGACGGACGCGTCTGGTGGCCTTTTCT
TTGTAGAATGAGGGTCCAGGCGGAGCTGAGGAGCAGACCATGAACGTTTACCTCCGGGTC
CGGCCTTTTTCCCAGGAGGAGCTGTCTGAGAACCAGGACCAGGTAAATCAGCCCAGATCG
TGGCTGGGGGGTCCTCGGTGGCCCTCGTGGCAAACTTTATCATTTGTGGAGTGAAATATC
ATCAGTTCTATTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1769..1868, 2048..2121, 2396..2614
1127..1129, 1769..1868, 2048..2121, 2396..2578
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved