Tetraodon_nigroviridis Locus slc25a3b
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis slc25a3b
Tetraodon_nigroviridis
slc25a3b
Un
SNORA53, SNORA53
4419..4620, 5151..5352
6936
CCTACCTCCACTCATAGGTCTCCCTATGTTCCTGCCTCTTCTAAAAGAAAGTATTCACC
ACAGACATTTCAATCCTCCTGCAAAGTGACCCTCTGTCCTTCTGCGTTTCTCTCCCGGGT
ACCAAACCTGCCCATCACCTCTTATCATCTCTGTTTCCTGCACCATTATTTCCATTGAGG
TCTGCACCAGTGACAACTCTCTCACTTCTAGGGATGCTCTGCATCACTTCATCGAGAACT
GGCCAGAATTTCTCCTTCTTCTCCAGCTCCCATCCCACCTGTGGAGCATACCCACTAACA
ACATTGAACGTGACGCCTTCTATTTCTAGTTTCAGACTCATCCCTCTGATCTATCTATCC
CTCCTCTGCATCATGTCCAATCGGTCGTTGACAACCCGGGGCCTCGACCGACCCGGTTTG
GAATTCATATTAAATTCGATTCGCATGTTTGATTTGGCAAAAGTTTGACATGCCCTTTCT
GACACAACCCACTATATTTATCCGGGCTTGTGCCCTCTTGTGGCTACATTACACCATAAA
CTAAAAATATCACTCCCGAATTCCAAATACAATTATATTCCTGCATTTATATGCAGGACA
TATTGATCTGCGAACACTTTGTAAATTAAAACGTCACTAGAGTGTTGTTTTAAAATCAAT
AACTTTTTTTTCCATTTTTTTGCTTTAAAAACACTAGAAGTCTTAGATATTTTGATAGTT
TTTTAGGGATTTTTTAATCATTGCTTGGAAGTCTGCTCAAACTCTCTATTATTAGCAAAA
TTAGTAAATCGGATAACTTTTGGACTCGTCTCTTTTTTTCCAGGGCTTTTTTTATCCAAC
AGAGTGATGCGAGGAACTTTTATTTGAATTCTTTACCGTGAGAGTAACGAAGTCGGCTGA
GTCGCCGGTGGTGGTCCAGGCCGCTTGGGGGCGCTGTGGAAAAGCAGGCGTGTTCTAATG
CGGAAAGGCCGCTCACGCTCACCGTGACGTCAGTAAGAGACGAACTAAATTACCCCGAGG
TCATCCAGCCTCTCCGAGCCGGTTGCACCCGAGTGAGGCGCCATTTTAAGACACTGAAAA
AGTAAGTAATATTAACCTTTTAAAACTGCATCGTATATAGCAAGGATTTAATAATACCAA
TGTATTAGTAATGACCTTTGAACCGCCCTTATTGTTTTACGTGACACATGCATTTTCGCT
ACGCTGGAGTCTCCCACCTTGACGCGGTCAAATTAGCTCAGTCTGGTTGCTTAACCTTAG
CTGGAAAATATAATGTTAGCCCATTTTTAAGACCACATCAAAATTCTGATGCTAAATCAG
GTTGGACAGTTTGCCTTTAGCAATTATTATGGTCTTTGTGGGATTTTCACTATCCTTTCT
GCGTTAATTCTGTGCCTCCAGTCGAAGCTAACTAGTGTTCGACATCGGATCCGGCTGAAC
TGGCTAGTGGTCATAGAAGCTAACTTGTTGCTCATTTGCAGCGCAGCTCGGCCAGCAGGC
AAGACGCCACCATGTATCCGACCGCTTTGACCCAACTGGCCCGGGCCAACCCGTTCAGCG
CGCCGCTCTTTAGCCTCCAGAAAGTGGAGGAGCCGCAGCAAAGCCTTTCCAAGCAGAGCC
CACGCAGACTGGCCGCGGCCGCCACCTCAGACGGTAAACCAAGCGCACACCGCTGCAGCC
CGGCTACGTTAGCATCGCCGGCTAGATTTGTCTAGTTACCGGTGAAGGGATGACAACGTG
TAAAGATTTGTTGTTAAAACTGTGCTGTAATTCCTGCACAGAAGTATTAATCTGTTTTAG
ACCAAGTGTAGGGTTTTCACCAGGCCACAAGCCTGTGGAGGACAAGGAAGGGCAAAGTGT
TGGCTAGCTTGTTCTCTGCAGCACGCTGACAAACGTTCCCCCTCTCCTCCTTAACAGCTA
AATAACAATGCAATTGTTTATTAAAGAATTAGAAACGAAAGATGTTTTTGCATTTAGGGT
TGAAAACAAGCACAGGCTGCGACTAAAACTATGTTGTACACCGAAACCTTTGCTGCAACA
GCCTGCATAATTGGAGTGTTTCCCACCCTGAGAAATGTTAACAATTGCCCCGAGGGTGCC
TGAGATGTCCTTTTTGCTAACGAAGGTTACACAGGTAAAAATGGTCTTGGTAAGTGACAA
AGACAATTTTGTCTCCCTCGCAGTTATTTTACGTCCCTGTTGACTTTTTCTGTAGAATGT
TTTGTCAAAGTAGTTCAAACAGGTTCTGCTAAACTGAAGGCTTAGTTCTTGTAGCTCAGC
ATTTATATTGTATATATTTATATTGTACGAGACAGGTGAAGGGTGTTTTTATCGACCTTG
TGGTTGAGGGAGTTGCGAAAAGCCCGGATGTCCATTTTCTTACAGCCTCCACTGTGTTAC
AGAGGGAGACAGTTGTGAATTCGGCTCTCAGAAGTATTTCGTCCTATGCGGATTTGGTGG
GATTCTGAGTTGTGGCACTACACACACTGCAGTTGTTCCCCTTGATCTGGTCAAATGCAG
AATGCAGGTCTGTCTCCATGACAACAGCACGTCTTATCCCCCCTTTATTTTACCTGCATG
GGAGTGTTGGACTGATCCCAGTGCTGTAAAGTTTTGTTGTGAAGTGATCCCATTTGGAAT
AATCACACCACGGATGCATGACCTCCGTGCCGGTGTTTTGTGATGATTGCTGCCTGCCGA
GCTTCTCCCGATCCTCCCCGAGCGGACACTGGTGGACCGTGAAGGTCAGCCGTGTCACAC
ACCAGCTGGAAAACACAGGAATGTTTAGGCTGGTGTCTGACACCGTCAGCTGGTTTTCAG
GAGGACACAATTCATGATTTTGGTGGTGTGAAAAAAGTGATCAAAGCCAGGTAAGTGTGT
ATGGAATTTGGGATAAAATTGCTTGATTTATTGATTATAATTAACTGAACTCAAATTGAT
CAATAGTTAAAGGACCATAAGTGGTGAGCAGGCCATGAGGTGGGAATGTCATTTTATTGG
AGTTTAGTGCCCGACACTAAAAACTCTGTTTATATTGAAGTGTTGTTAGATTGTTAGATT
TTAAAACGGCCATCTCACACTCTTCTGGTCCTTTAACTTTCATTCCTAAACAGAAATCTG
TCGGGTGCTGCTGATGTAATGGCGGTCCGTTTGAGGCCGGCCTTCTAATGGGAGACTTGT
TGGGGTCCTGTGCTGCACCAGTATGATTCTTCCCATCATGCAGCCCTGCTGTGCTGTTGA
TTTTGTCTGTGTTTTGCATGTGACCCCCCTTGCATGTTGCATGTTTTGTTTTTTTTTTAA
TCACAGAGGGTGTGAGCTGCGAATTTGGTTCTTCGAAATACTATGCCCTGTGTGGGTTTG
GGGGAATCCTGAGCTGCGGCATCACACACACGGCAGTGGTGCCCCTCGACCTGGTCAAGT
GCCGGCTGCAGGTTTGTATGGAAACACGGTGTAGCAGGAAGAACGCAGCAGCTCCAATCG
CTGCAGTCTCATTTGAAATTAAACAGAAGAGACGATAGATGAATCTGACCACCCCAGAGG
GGATTTAAAATATATTGATCTCTCTCATTGCATTAGAAAAACTGCAGACATCCTGCTGCC
ACGTGGTTGTGATGGATGTTGATAGCCTTGACAGTCAGAATAACAACGCCCAGGACTGTC
ATGGCCCTCTTCTGACAGTTTTGCACGCTGCGCTTCTCCAGGTGAACCCGGACAAGTACA
AGAGCATCGGCAATGGCTTCTCCGTCACAATCAAGGAGGATGGCGTCCGAGGCCTGGCCA
AGGGCTGGGCCCCCACCTTCATCGGCTACTCCATGCAGGGACTCTGCAAGTTTGGTTTCT
ACGAGGTTTTCAAGATCCTGTACAGTGACCTGCTGGGAGAGGTGAGAGCAGCTGCAGGAC
CGGCGGTTGTCAGGGAGACGGTGGTTAGATTGGGGAATGAGCAGCAGCAACAACGACCTT
TCGTGGTGGTCAAAGTACAGACAGCCCTCGTGTTTTAGGTCACACCGCCTGGAGGGTGTG
TTTTTAGATCAGAGTATCAGTGACAACACATGAAGTGTTTTGGTGTGTGTGTGACCCCCC
ATGCTCCGCTGTGTGCCGTGGCAGGAGAACACCTACCTCTGGAGGACATCGCTGTACCTG
GCTGCGTCGGCCAGCGCCGAGTTCTTTGCAGACATTGCCCTGGCCCCAATGGAGGCCGTC
AAGGTTCGCATCCAGACCCAGCCAGGCTACGCCAACACCCTCAGGCAGTGTGTCCCCAAG
ATGTTTGCGGAGGAGGGGCTCTGGGCGTGAGTATGCTCTCTTCTTACCTCCCTAGTGGTG
GCCCAGGTCAGAGGGCTGAGGACAGTGTCATTTAGATGCTCGTTTTTGATTAAAGTTGAC
CCTTTCGTGGTAAAATCAGCTGTGGATTAGGGATCAGCTCACACGCTCCTTAGATCCACC
TCTGGAGGGCGCTGTTCTCCGAGCAGAGCTCCTCAGCAGCTTCCTGCTGTACTGTCGGAG
GTGCTTGAGTCATTGGCGTGTTAGATCAGTCCACCTGTCCTCCAGCCCACCTGCAGCACT
GACCAGCCTGCGTTCTAAACACAGGAAGCTCTCACTGTTGTCACGCTGGGGGACGGACAC
GTTTCACCTTCGGTTCCAGGTCCTCTCGGGCTCCACTTGATTATTTTTTTTATGGTTCGT
TCAACATTCAAAACACAGTGGCGCTGTTTGGTGGTCTGCTCCAGGTTCTACAAGGGTGTG
GTGCCGCTGTGGATGAGGCAGATCCCATACACCATGATGAAGTTTGCTTGCTTCGAGCGA
ACGGTGGAGATGCTCTACAAGTACGTGGTGCCCAAACCTCGCAGCGAGTGCAGCAAACCA
GAGCAGCTGGTGGTCACCTTTGTTGCTGGTTACATCGGTGAGTGTCTACGGTTGTGTTGC
ACTTTTTAGGAATGTATTTAATGTGATTTAATACTTTGGGTGCGGCACTCCGGACAGGCT
TTTACATGACTGTTCTGTGTCCCACAGCTGGTGTGTTCTGCGCTATCGTGTCCCACCCTG
CTGACTCTGTGGTGTCCGTGCTGAACAAGGAGAAGGGCAGCACCGCCGTCCAGGTCCTGA
AGAGGCTGGGGCCCAAAGGTGCGTTTCCTCCGCCGTCGGTTGGTCTTTATCCGCACGCTC
CTTAGATCCACCTCTGGAGGGCGCTGTTCTCCGAGCAGAGCTCCTCAGCAGCTTCCTGCT
GTACTGTCGGAGGTGCTTGAGTCATTGGCGTGTGAGAACAGTCCACCTGCCCTCCAGCCC
TCATGCAGCACTGACAACCCTGGGTTCTGAACACGGGGGTGCACCAGTGCTGCCAGTCTG
GGGGGTGGACATTACCATTTCCTGCATTCGTTTTGCCGTGGTACCTTGGAAATTTATTGC
TGGAAACAAAAACTAGCCTGGTTTCGTGTAGTTCTCAGTTTGGGGGCGGAGAGTTTGAGC
CCCAAACATGCTGCAGTGTCCAGAGTGTCAAACGTTTCCTGGAAGTTCTAATGCAGGGGT
GGAGCACTAACGCGCTGTCTGTGTCGCCAGGGGTCTGGAAGGGCCTGGTCGCCCGTATCA
TCATGATCGGAACCTTGACCGCCCTGCAGTGGTTCATCTACGACTCTGTCAAGGTCTACT
TCCGCCTGCCCCGCCCCCCTCCCCCAGAGATGCCCGAGTCACTGAAGAAGAAGCTGGGCC
TGACGGAGTGAAGGGTCCCCTCACACACACATACACATACACACACACACGCGTGTGCAC
GCAGCAGGATTCTGTATTTATGACTTCTCCTGGGCTCCAGCACACAGGCTCCTGTCCTGT
CCTCCTGGATCTTCAACATGGGACTGTCCAAACATTCTTTAGGGACACATTGGTCTGCTT
TTATCATTTCTTGTCCTTTAGAAAATGTAGAAACTCTAATAAAAGAGGTTCCCTGAACGT
GCCTGTACTTTTGTTTCTGACCTGATGCAGCTTCTCATGCAGCCATGAATCCCTGGTCTG
GTTTGTCTGGTTCAGTCCTGTGAGCTTTGATGGTCTCGGACTCCCACAAGCCGCCTAAGC
CACAACAACTAACCCTAACCATCTGATGAGGTTTAGCATGAGGGTGTAACGACTGTTGTT
GGACCAGTGACTGACTGGTCCATGCTGAAGCTTCTCCCACCTCTTAGCACATTGGTGTTC
CAGGACCTCTGCCAGGAAGCTCCAGGAGTATCTGGAAGCCTTCAAGTCTGAGGAGAAGGA
GGTAAAAGTAAAGACAGTTAGCAATTATTCTCAGAATATCGACGTATTTCTGTGGACTGG
CTCTAAAAACCAGAATTGACAATGGAACAGCAATGGAAGCCTTCCCGCTCTCAGTAAAGA
TGAAGATGAGGTGTTTTGCAGACAGGTAAAAGCTTCAGATGAAGGCCCAACAATGATGAA
CCAATAATGGTTCCCGCAGCGAGCGAGCGGTTTGTCCCAGCAGATCTCCGGCTGCTGATG
TGTGAATCACGCTGCCTTAAGTGGAAGTAGAGTACACTCTTCATCACGGGGCCACAGCGT
CGCACACACACGTTATCCATTTGTCTGCTCTTAGGACCATCTGTCTTCACGGCGAAGCCT
CCTATCTAACAGTAATGCTGTGCGGGGTCAGTGGAAATGGGTTCCATTTGGTGCTCTTAT
TTTACGAGGTTGTTACTAAAAAAGCGACAACTAGGACAGATAAAGAGCTGTCATTTTACT
CGCATGTGACCTGAACAACTCTGATGGCACCAGTCCTGCTTTAGCGCTACATCTGTCTCC
CAAGCGCTCCGGAGAAGGCGGCAGCGCCAGATCATCCCAAAACCAGCTCCCCATCCAACT
ACACCAGGATGAGTTTCTCCCTGATCAGGAGGACCTGATCAAGGTTTCATCCTCTTGCAC
TGTTTCTTTCCTGAGGACAGTTGCTTCTTTGGAGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1486..1652, 3306..3430, 3701..3880, 4104..4285, 4724..4896, 5007..5117, 5550..5936
1511..1652, 3306..3430, 3701..3880, 4104..4285, 4724..4896, 5007..5117, 5550..5710
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved