Tetraodon_nigroviridis Locus Poly:SNORD25
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD25
Tetraodon_nigroviridis
Poly:SNORD25
Un
snR56, SNORD26, SNORD29, SNORD30, SNORD22, SNORD31, SNORD31
1001..1064, 1491..1566, 2378..2442, 2610..2679, 2828..2954, 3124..3193, 3332..3399
5064
TCCTAAATTTTTATTATGCTTTGATAAATAAAAAGCAGCACAGGTAAAATAGTTTTAAA
GCCTTTTTTATCCAAGCATGTCGAAGTTTTTTTACATTTCATATCCATCAAAATCAGAAA
GCAACCTTCTTCACAACTGCTCATTAAAAAAAAACTTTCATTCTAATGACATTTTTGATG
ACTTTTATCACAACACCAGCAAGCATAATAAGTAAAACAACACAAAAAGGCCATACAGGT
ACAAATACGCAAAGAACCTACAAAATTGGATCATTAATACGTTCAATATATCCGGTCATT
TCATAACTTTTTGGTATCTTTGTCGCCCTCTTGTGGCCTTTAAACTTTTCAAAGGGAAGT
GACGTCAAGAAGGGGGCTCTAAAATAATTTCCCAAACAAAAAATAAGTTAAAGACGTTAC
TGGTAACAATAATGGCTACACTGTGTCTCAACGTTTTTGAATCGTTCGCAATTGCAAATG
TAGCCCCTAAATATTAGTTTGTGCTACGAGTTCAGCGTTTCCGCTGTGAGTCGGTAGGAG
GAGCTCCGGGGGACATATAAAGCAGACGGACCGGTTTCCTCGTCCACTTCCTCTGCTCCC
CTGTTGCCGGTAAGATCAACCTCTAGCTGTTTAAACTTGTTATTCTGTTAAAAGAAACCA
ACCAAACAAACTCTTGTGTTAGGAACCAAGCTTGACTTTGCAAGCTTGTTGTTTGAGATC
CAGCAGAGTTGTAATCGAGCACTTCCAGCTTTGGAATTTGTGGGCGCTTAGCCGCCGCTG
CGCTAACCGGTAGCTTAGCTACATGTCAGGGCAAATCATTGCTGCAACGCAATCTTAATC
CATCCATCGATGCTCCACGTATATTAATGGTAAAAAACATTGTTTGCTCAAATTTAGCTG
TTTTTCCCTGTTTAATAATGCAGTATTATTTAAAAATATATATATATATCGTCTCCCTGG
GTGCTTTTGGTAATGCTGGCCAGATGAGGCTCGATCGGTGTCTCGATGATGATAATTCTC
ACAGACCTGTACTGAAAACTGTGATTGCAACTATTAAATCTGATGAGACATTTGTTAAAA
TGCCGATAAACATTGCCAACACGTGTTTAGCACGTGCACAGAGTCGGCTGCAGGAGCGCG
AGCCACCTAGCTACCGCGTGCTAACCGGCTATTTCTTTTTTCAGGATGGCGAGGACGAGG
AGAGAACTTAGGCCACGCAAAAGGTGAATATTTACAGCTGTTTCAGTCGTGTTTTTAGTT
TTCTGGGTGTACAATAAACGTGGCGCTACAGTGATGTTGTTGAACTCTCTCACTGAATAC
CCCTTGAGGAAGCTTTATTTCAATCCACTGAGTAGCCAGACCAGAAAGTGCATGTTATTT
ATTTTTTTTCTTAGGTCAAAGAGTTAAACTGTGTCTTGTTCTCTCCAGGCTCAACAGAAA
CACCCAAAGGTAAATGCTTTTGCATCTAAATCCTGCATTAATGACTTTTTGCTGCTGTGA
TGAGACTATGAACTCTCTCTTACTGAACTGGCTTTTGAAGAAACCTCTTTACCAGATTCT
GAGCGGAGCCTAGCATGTTCCAGGTAGCTCAAAGACGGAAACTCTTCAGTGAAACCCTGT
TTTTGTTCCAGATGTCAGATCCTGGCTGAAAATGCAGAAACCTGAGCAGGTGAGAAGTCT
AACCAGCTGGCGAGCGGTTGAGCAGTGGCCGTGGCTGATGAGTTATTCATCTAGACAAGC
ATATGCCTGACTGGAATGATGCCACCCTTTGAATCTGATAAGGCCACTTTAGTGTGTGGA
GCCATCTTCCCCTCTGGCTGCCCGCCTAACCTCTGCTCCTCCTGTCAGGCTGCTCTCTGC
TCCTGCTCAGCTCCAGTGATCAGCCCCGTGAAGAGGTGAGTGACCCCAACCAGCCTCCTC
TCTACTACTGAGGCTTTCATGTGATGATTCCAATCATGACAAGCATATGTCTGATTTGCA
GTGATGCCATGCTCGATTCTGATCCCCAGCGTGTAAAATAATCCGTCTTTTATCGTATTT
GTGTGGGATTAACGCGGGTTTTGTCTTCCAGGCAGGAGGTCTGAGGATGAAGAGGCCACG
TGGATGGATGAGGACTCGAGTGTAGGTGCTGCACATGTTTTGAGTCAGACTGCGACTGTT
TGAAAGGATGAAATGGGGTAAACCCATCAAACACCTGGACGGCTGTGGCCCCATGGCGGT
TTGTCACCAAAGCCCTGATCAAACCCAACCTGTGCGCGCGGCAGCTCAGCGGAGGCCGTC
GTCTAACGCGGTCCGTCTTTTCCGCAGCTTCTCCAGGAGAGGATGGAGGCCGCCGGCGTC
GGCCAGGTGAGCTCCAGCCTGCACGCGTTGGCGGCGCGGTGCAGTGATGATGAAACTTAG
CTCACTTTGACCCCATGTGAAACGACAGGAACATCTGAGCATCTGCGCTTCAGCGGCCGC
CCCCCAGGCTCCCGCAGCCAAACGTCCACCCCATCTAACCAGATCTGTCCTGTGTCCCAC
AGATGCCTGACCGGGTCTCCCCGCTCCTCAGGTGCTTCCAGACCAGGTAAGATCCACGGC
AGCGACCCCAGAACTTCTCCTACACCTGCTGACAGTGATGAGAGAAACTTGGAATCTCGT
TCGTCTGAACAGCTGTTGAGAAACGGAATATCTGACATCGGCGTCGGTCAGGGTTGGCGG
TTGCAATCCACCAGTTCCCGTCTTGACCCTGTCTCTCTTTCCAGGTTTCTGCTGAGGGTG
CAGATGGATCCCTCCTCCCTGGTGAGTGAACACATGGCACGTTCAACATGGGGGGGGAAC
CCCGGTTTCCTTGGTGATGACACCCGCACACGTCCGTCGCCTCGCGCCAACGCCAGAACC
TGAGAAGGTGAACCCACTGGCGTTGCCTTGGCAGCCGGGGGAAGACTGGTTGGGGTTACC
AACAGTCTGAAGGGAAACCCGGGACCGGATGCGAGCTTCTTAGCCCCTTAATGGGCCAGA
ATCTGATTGGTAGACGTGTTTACAGGCTGGATGGGCTGAAAACGAGGAGGACGTCTGACT
CGGCGTCTCAGCTGAGGTATGAATCTGTCACGTGTCCTTTTTTTAGACACATTTGACTTA
AAATCCCACCAAATGATGAGTACGTTACCGCCCCAGTCTGATAACTCGTGACTGATGGGT
ATTTTCTGACTGAAGCTGTTGGGGTGTCCTGATCTGCTCGGCCAAAGCAGATGGACTAAC
TGCTGATGTGCTACAGGTTGGACCTGGCGGGGATCTTCGGTGGCACGCGCCCGTCCGATC
ACTGAAGGTAAATGATGCCCCAACCAGGATTGGAGTCAGATGATGAGTTAGTTACCGCCC
CAGTCTGATTATTCATGACTGATTGGTATCCTCTGAATAAAACGCCCTCATCAAGCCAAT
CCTGGCAACAAAATGTGTCTAAACTAGTTAATTTTGTGGTTTTAGGTATTCAAATAACGC
CAGTTGTTGTTGCAGGTTTGGGACAGAAGGCGGCGCCATCGCGCCGATCTGCCAGCGCCT
GATGGCTGAATTCATCCGCAGCACTTCCCCAGCAGTTGGAGCAATAAAGTTGTTCTGACA
GCATTGCTGACTCCAGTGTGTTTAATGTTTATGGAGAATGTGAGACACTTGGCAAAGTAT
TTATAACCTTAAACCGCATAAATAACAGGAAGTGAAGTCGTGCGTCCCGAATTGAGATGG
TACCAGTTCCTCCAGTCCTTAACTGGTTCCAGTTCATTGGTTCTGAGTCCCTTGGTCACT
CCGCGGTGAAGATCCTGGCAGCGATGTCGTCCAGTAACCAGTCCACTCCCGTTAGCAAGT
TCTCGCCGGTCACCGCGCTGCAGCCCACGATGCACCAGTGGTGGCTCCTGATCTGGTCCA
GGGCCAGCGCCTGCAGGACAACGGCCACCGTGAACATCACAGCAGCTGCAGTACCACGGA
AGCGCTCCTGTTACCTCCTGGATGGCATCCTTGGTCAGAGCTCCAGGCAAATCCTGCTTG
TTGGCAAACACCAGCAGCGTCGCGCCAGCTAACCTCTGCGTGGGGGGGACAGAAGGAACC
ACTCACAACCAGGGTCTTGAGAAATCTGTTCTTTTGGAGTCAAAGAGGCCCGAGTTCCAC
CTCCTCCTGCAGCAGCACGCTGAGCTCCAGCCTGCAGTCCTCCAGCCTGAGCCTGTCGGC
GCTGTCCACCACCCACACCAGCCCGTCGGTGCTCTCGAAGTAGTTCCTCCAGTAGGAGCG
CAGGGACTTCTGGCCCCCCACGTCCCAAATATTCAGCTTGAACCTAGAAAACACAGGCTT
TTCCGTGAACGCTGCGGTGCTGATGTGATCCTGTGGGGGGAGCGGCTGGTTACCCTTTGT
GCTCCAGGGTTTTGATGTTGAAGCCCAGCGTCGGGGAGATGGTGCTCACGTCTTCCCCGT
TAAACTTCTTCAGGATGGTCGTCTTGCCTGCGTTATCCAGCCCTCTGCAGGGGCCTGGTC
AAAGAACCAACGCACACGCTGAAGATGCTAAAAGCACAACAAAGACGACCAAGCGCCAGA
GGTCTTAAACAGCAAGTATCTAACGAGGCCGCTGTTTTATAGCGATAAAGTTTCTGCGGC
GATAGACGCATGTATGCTAGTTTCCAGCTAAGCTAACACGCCGTGACAAGGATACAACAT
TAGCAGCCTCATTTCTCGCTCCTTCTGCTTCATCTTCTTTAGAATAGTCAGCAAACCCAT
CGCGAAGGTGTCCGGTTCAGACGCACACAGTTTTACAAAAACAGATTATCTTTTATCAAG
TGTAATACTTTTTATGGTTGGGGTACAGTGAGTAACAACAAGCATCGCGAACGAGGAAGT
GCTGTACATTGGAACCGCCCCTCGCAGCCACCGATTGGTTCGTTTCTGGAGGAGTGAAGA
CTGATTGGTTGAATCATGCCTCAGAAGGCGCCTGATTGGCCGGTTCTCTTTTTAAGGCGC
GGCTGTAGAATAGAGGCTTATATTAACGGGATAGGCGCCCCCGTGTGGTTGTATCTCGAA
ATTCACTCGCAATTTAAATTTAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved