Tetraodon_nigroviridis Locus Mono:SNORA8
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA8
Tetraodon_nigroviridis
Mono:SNORA8
Un
SNORA8
1001..1136
2136
CCGCAGCACCGCTGTTGCTGCTCGGTGCCAATGAGGCCTGGAACACGGGCTTGGCTCCG
GGGGACCGGTGAGCGTCCGAGCTAACCGCGCTCCACCCTCTCTTGCAGGCCCCAGACGCG
TCCCCGGGTGGGGGTGGAAAGGACCCGAAGGCCCGCTGCTCCTTGGCCACGTGAGGTTGG
TTGTTGGGACTTTCTTCGGAAGCCACGTGACCTTTCTCGTTTTGCGGTGTTTTGTGTTGG
CATGGCAGCTGCAGGGGTGTGTCAGCACGCTGTCAGCTGTGCCTCGGTCACGTGGGGCCT
ACGGCTCAGGCAGTGCTCAGAACAGAAACTCCTCTTGCAACCCACTGCTGCTGCCACGGC
AGCAGTGTTACTGATGAGGACTGACAGCAGAGGCGGAGCTGCTTGTCTCTCCGCTGGTCG
CTCACGCGTGTCCTGTCCTCCTCAGGTCCTGGGTTGGACTTGGACACCCAGGCCACGGGT
ACGTTTCACCCCTGAACTTGCTGTCTGGTTCAACGTGATGATGATGGCTGAATTTGTTCA
ACTGCGCTGAGACGTGAGGACAGCTGCCTCTCTGAACCAGGCGCTCTGCTGCTGACCTAC
CGCACCTCCTGAGCGACCTTCTGACCTTCTGCTGCTCTCCGCAGGCTTTGGCCCCCGTGC
AGCAGCATGCAGACTGGGTGAAAGGTCCCCGAGCAGCCGGAGAGGCCCCTTGGTTCCGAT
GCCAGGCTCCAACCAGTGTGAAGGTGAGACCCGGAGCCGGCGGACAGGCGGTGCTGAGGT
CTTCCAGACGGGCTCGCTGCCGTCGGGTCGGGTCGTTGAAGGTGCCTCAGAAAGAACAGC
TGCAGTTTGCTTTACCCACGGCGGTCCCTGCCGTGACGCTTGTGGGATACTGCTGCAGGA
CACGCTCGGCCTGGTGGGACTGCTGGATTAACCTGTGTCCTCCTCAGGTGGTCACGTGAC
TGCTGCTGGCCGCTGAGGTGAGTGTGCGTCTGCGAAGCTCCAGCACTGCGTGGTATCTAC
AGCCAGATGCTTCATCACCTGGCTCGTTCAGAAGTCAGTGCCAGACTACCTCAACGCTTG
GCATCGTTGGTCTCCATAGCAACTGCTGGGAGTCCTGGTAGTTGTGTTGAAACATTTTGG
ACAGGATGATTCTGTGGGACATGTGGATGTGTGACTGTCGTCTAACTGGACCAGAACTTT
AACCCTGCCTGGTGTGTGATCCTAAAGGTTCCCTGGGGCTTCTGGGGACTCGGCGTTGCT
TCTCCAGCAGGTGAGGTTCCCTTCATGCAGCACACCTGAGCGTGGGGTCATATACCAAGG
CTGTCAGGACTCTGTGCTCGACTCGCTGTGGACTTGACCCAAAATCAAACTCCCAGTGGG
CTCCTGCCTTGGATGCCTGCAGGGAACATCCTCATCATCCTCATCATCCTCATCATCATC
TACCTGTGAGCAGATCTCCGAGTGTTGACCTTTTCGTGTCCTTTCAGGATGGCTGCAGAA
ACCAGGCGCGCAGTCTGTCGGTGCTGATCTGCCTCTGGAGGTTTGAATAAAACACTGCCC
AAACGTTCATGGACTTGTGTTCCTGCTTGAGAACAGATTCCGCACTACTGAGGACATATG
AAGGGGTTATGTTAGTTGGGTTAGGGTTAGACCGCTTTGGGTCGCCAACCTTGAAGCGGT
TCCAGCGGCAAAGTTGCCGCCAGAGTTGAGGAACCTGAGGGAGAACGTCTTTATAGCGCG
ACTGGTTTGACCCCTAAACTGAGTTGTGTTCAAGTTGGACATAAGCGGGACAGGAAGTCA
AGAGGGGGAGGTCCAGAGACGTGGGACCGTCTGCCTGGAGAGGCTCTGAGACGGTCTCGG
GCTCCACCAGGGGGCGGTGTGTTCAGATCTGATCCTTCTCAGCCGGTTCCTCCTGGAGGC
CGAGGCTGCTCACACGTCTCGCTGGTGTTCGGGCCTGATCCAGGAGATCCAAACGTGTGT
GTGTGTGTGTGTGTGTCCAGCTGTTCCAGGGGAGATCAGGCTCTCTGATCCTGCCAGCTT
TCCTGGAGCCTCCCTCAATCTGTCCATGTTGAAAGGTAAGTCATGTGATCTGGACAGTCA
CAGCTTAGTCAGCGCTTGTTTACGCTGACGGAGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved