Tetraodon_nigroviridis Locus sf3b3
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis sf3b3
Tetraodon_nigroviridis
sf3b3
Un
SNORD111
3819..3892
11524
CTGTACTGGAGAACTTCCCTAGCTCTGGTCACCATGAATTCCTCTGCCAGGCTGCTGGA
GGGGAGTGTCAGCTTGTTGTTGTTGCCATAGAGGGCATTGCTGAATTGCTGAATTCTATT
GCTAAAATAGAAGTAGCAAGCGTGATTTCACAAAAGTGGGTGGTTTTTTTATAAACAAGT
CTTTCTCGCTGAGTTTTATTGTTAAGCCATTTTTTTCGCTCAACTTATCCCCTCCTCTTT
GTCGACACCTTCCGGCCATTTGGGTCCACTGCGCCATGTTGTTTTCCCCGCCTTCTTTGT
GTTCAGGCACTGCGCTGGACACCTCACGTGACGCGCTTTTGTTAGTCGAAGGACCCAGAA
ACGGCGCCTTGTCGTCGACCGGCCAGAAATTCGGGCAAGTTCATATTGCAAATGAAACGT
AATCCATCCAAAATCAAAGGCATCGTCTCGAAAACAACGGTAATTTTTTTCTGTATGTGT
GTGTGGCGGGTGCGCGGTTGCATGGAAACAGTATCTGCTAAATTCAATGCTTTGTTTTGA
AAGATTTAGTCAGAAAATGGTTGGTGGCGTCACTTTTAGCCGGCGCTTTCGATGAATGAA
TGAATGAGTTCTCGCTCCGCGTTGGACAAAACTCTGAACTAGATATTTAACCTGCGGGCA
AAGTTTTTATCGTCTAAGCGCTAAGAAATGTTTTGGTACCCGCTAGTTAGCGAAGCGAGC
GGGGGACTTGTGATCGAAGTTGTCCTGTACCGCTAAGCTAATGTTGTCCATTTGTCCGGA
CGTAAACAGCGAGCGACAGACGTCCCGCCTGTGTTCTTCCTCGTTCCTTTGGACCCATGT
GGAGCCATGCCCTGCTAGAAATGCCTGTTTGCTGACTGTGTTGCAGCTTTGTTCAGCCGT
AGAAAGGCCACCGGCGTCGGCAGCAGCTTGACGGGATCTGGCGGCTCTGAGCGGGGCTCG
GCTGTGTGGTGGGCCCTCCAGGACCCGGCGGAAGGAGAGCCATGTTCCTCTACAACATCA
CGCTGCAGCGCTCCACTGGCATCACTCATGCCATCCATGGAAACTTCTCAGGTCAGCATG
CCACTTCTCCTTTACTTGTAGCCTAGCTAACCCACTGAGACAGAATATAAGTTTAAAAAT
GAAGCTTAAAAATGTTTCTGGCTGCCCAAGTTTGTCCTGCGGAGTTGTAAACGCAGTACT
CGGTCTTTGTAGGAACCAAGATGCAAGAGATTGTTGTTTCCAGAGGAAAAATCTTGGAAT
TACTGCGACCAGATGCTAACACGGGAAAGGTGCACACTCTGCTAACAATGGAGGTGTTTG
GCATCATTCGGTCCCTGATGGCCTTCAGACTCACAGGAGGAACCAAAGGTACGTCGGCAC
ACCTTTATTGACGCGCCTGTTTAATAAAGCTGATTAAAAAAACAACTTGTTTGCTTGTTT
GCAGATTACATCGTCATTGGGAGCGACAGCGGTCGCATTGTCATCCTGGAGTACAGTCCT
TCCAAAAACATGTTTGAGAAGATCCACCAGGAAACCTTTGGGAAGAGCGGCTGTCGGCGC
ATCGTCCCCGGACAGTTCCTAGCAGTCGACCCAAAAGGCAGAGCTGTGATGATTGGTGAG
GTTTTGCTAGCCGGCTACATTTAGCTGTTAATAGATTTGGCTTCTAAAGTGGGTCCTAGT
CGAGCAAATTTTCAGCCTGAAGGGCCACGTTGGCTTTTAGATCTTGATGAACAGGCCGGC
CAGGTGGTGCAGGAAGCTAATCAAGCTAATCAGGTGGTGCAGGAAGCTAACCACCCAAAT
GAGGATCAGAGGCTAACTAAAAACCCTGCTCGATGAACTTTTGACAGAAAAACTATTTTG
AAAAGCCTGTGAACTGGTCCAGCTAGAGATGGACGATGAAGCTCCAGATGACGTCTGGCC
CCACCTTCTTGAGAGGACACGTTAGCATGCTAGCTGAAGGTGGGGTCTGAACCTTGTTCT
AACCAACCCAGCTGACAACCCTCTTCATTTGGCTTTTAGGAAAATGACCGTGAAGGCTCT
GCGGGCCGAATTAAATAGTTCATCGGGCCATATGTGGCCCCCGGGCTTCAGCTTGCCCAC
CTCTGGTCTTACTTCCTGATGTTCATAAGGGATCAGTAGATTAGCCTCTGCAACAGCTAA
ATGGGTAAAATGAGAAGTCGGTGTTGTTTCCTCCATCCAGGAGCCATCGAGAAGCAGAAG
CTGGTCTACATCCTGAACAGAGATGCTGCTGCCAGGTTGACCATCTCCTCTCCGCTGGAG
GCCCACAAAGCCAACACGCTGGTCTACCACGTGGTGGGGGTGGACGTGGGCTTTGAGAAC
CCCATGTTCGCCTGTCTGGAGATGGACTATGAGGTGAGCTCCTGAAACACCGTGCTAAGG
TGACGCCAGTATTGCTGGGTCTTTGCTGTGCGGTGGGTGGCTAACAGGACGACTCTCTCC
TCAGGAAGCCGACAACGACCCGACGGGGGAGGCTGCTGCCAACACGCAGCAGACTCTCAC
CTTCTACGAGCTGGACCTGGGTTTGAACCACGTGGTCCGCAAGTACAGCGAGGCTTTGGA
AGAGCACGGGAACTTCCTCATCACCGGTGGGTAGCCGCGGCGGCGAGCCGCGCAAGCGTT
CTCCATCCGCTGACGCTCCTCCCCCGGCTGCTGTTGTCCCTCCAGTTCCTGGCGGTTCCG
ACGGCCCCAGCGGAGTTCTGATCTGCTCGGAGAACTACATCACTTACAAGAACTTTGGCG
ACCAGCCGGACATCCGCTGCCCCATCCCACGCCGCAGGGTGAGCGCTAATCACGGGAAGC
TAGGATCCCTAGGAAAAAGCGCTGGTTTAACCGCCCTCCACCTCTCAGAATGATCTAGAT
GACCCGGAGCGAGGGATGATCTTCGTCTGTTCCGCCACCCACAAGACCAAGTCCATGTTC
TTCTTCCTGGCCCAGACAGAGCAGGGGGACATCTTTAAGGTCACGCTGGAAACCGATGAA
GAAATGGTGAGCCAGCGCTGGCCTCGCGAGCGCTGCTTAGCCGCTGCTCGCTCCAGGGAG
TGGCCGGGCAGTCGGCCTCACGGTTTTGTGTTTTTCCTCCAAGGTGACCGAAATCCGGCT
GAAGTACTTTGACACCATCCCCGTGGCGACTGCCATGTGCGTCCTGAAGACGGGTTTTTT
GTTTGTGGCCTCAGAATTTGGAAACCAGTGAGTTTTTTTTTTTTATCGTGGCCGTTTCGT
TACCGGCGACCTTCTTTCCCTCTCTGATGCGTTTGGTTGTTGTTGCGTTAGTTACCTTTA
CCAGATCGCCCACCTGGGGGATGACGACGACGAGCCCGAGTTCTCCTCGGCCATGCCCCT
GGAGGAGGGAGACACCTTCTTCTTCCAGCCCCGGCCTCTGAAGAACCTGGTGCTGGTGGA
CGAGCAGGAGAGCTTGTCGCCCATCATGTCCTGTCAGGTTGGTGCGGCAGAGGCCGAGGG
TTAGGCCGAGGGTTAGGCCGAGGGTTAGGGTTAGGTCTAGGTCTGCCTGCCTCTACCTGC
CTGTGACTGTCCCCTCTCTCCTGTGGCAGATTGCTGACTTGGCCAACGAAGACACGCCTC
AGCTGTACGTTGCGTGTGGACGGGGACCTCGGTCCACTCTGAGGGTGCTGAGGCATGGAC
TGGAGGTAGGCCCGTAGCGCTGACACCATTAGTCCAATAACGGCAGGAATCCCATTACTG
CAAAGGTTCAACAAAATGATTTCTCATCGGTTCGCCCGATTATTGGCCAGTATTAATGGA
ATACTGGATTACTAAAGTAATGGATTACTAGCAGCCCTGTTGAAAAGTGATGAGTTTGTT
CATGTCTCTTCTCTGAGTCAAAAGTGAAGAGTGTTGAATGTCTCTGATTTCAGGGTCACG
ACCCTCCTGGTGTGCAGAAACGGGGTTTTTAATATTCGCCTGACCTTAGAGACCCGCTGA
CCTTTGACCCCGGCAGGTCTGGCTGTTGGGCTGCTAGCGTCAGTGCTGTGTTTGCTGAGC
TCCAGATAGCGCCGGCGGGCTCGGTGTTCCCCACGGCTGGTGGACCCGTGTACGCCTCTG
GCTCTGAAGGGGGTTGTGTTCTTTCAGGTGTCGGAGATGGCGGTGTCAGAGCTGCCCGGT
AACCCCAACGCTGTGTGGACGGTCCGCAGGCACGTGGAAGGTAGGCACACTCCTGGAGGC
AGTTTACCAGAGAACTTGATCACACGTGTACACTTTTAGCCTTTATGAAAACATTACTGT
AGAATCAGGCGGGTGCCGCGTGAGGAGGCGTTTCTCTGTGCTCCGAAAGGCTGCTCAGCC
TGGCTCCGAGCTGAAGCAGTCATCCGGTTCTTGTGTTTGTTTCCTCGCTGGTGTGCTCAG
ATGAATTTGACGCCTACATCATCGTGTCCTTCGTCAACGCTACCCTGGTTCTGTCCATCG
GGGAGACTGTTGAGGAAGTGACGGATTCCGGGTTCCTGGGGACCACGCCCACTCTGTCCT
GCTCGCTGCTGGGCGACGACGCCCTGGTGCAGGTGGGTGTGCTCAGGTCTGCTCGGGTTG
GCTTCCGGGCCAGACCGCTGGAAACCTCCCCCGTGTCCCCCTGCAGGTCTACCCAGACGG
GATCCGTCACATCCGCGCAGACAAGCGTGTGAACGAGTGGAAGACCCCGGGAAAAAAGAC
CATCGTCCGCTGCGCCGTCAACCAGAGACAAGTGGTTATCGCCCTGACCGGAGGGGAGCT
GGTCTACTTTGAAATGGACCCGGTGAGTGGTCCGCCATCGGTGGTGGAGGCCGTAGACGG
GGGGGGGGGGACGGGGGGGCGTGAGGTACCCGGGAACAGCTTCCTTAGCTTCCTTGTGTG
CCTGTCCCCAGTCGGGCCAGCTGAACGAGTACACCGAGAGGAAGGAGATGTCTGCCGACG
TGGTCTGCATGAGCCTGGCTAACGTTCCTCCGGGGGAGCAGCGCTCCAGGTTCCTGGCCG
TCGGGCTGGCGGACAACACCGTGCGCATCATCTCCCTGGACCCCTCGGTAAGAACAAGCG
CCCGCTGGTGCCAGCAGGGTCGTTCAGCGGCAGAATTGTATCCGGTCCAGACAGGACAGC
TGTGTGTGTTGTCTTCTGGTCTGGAAGGGAGAGAGCGGCAGAGCTAGCAGGGCGGTTGTC
TCTGGGCTCCAGAGCCGAGCTGGTTTCTGCGGCCACCTGTGGGTCAGACAGAGGTGTGCT
AAAGGAGGTCCACCTCTTCTGGCAGCGGGTGGGAAACCCCTCTGCTAGGTCTGGACCCAC
CTTCCCGGAGCAGGCAGAGACGTGTTCTCCTAACGGCCTGTCCACGGTTCTGCGTTCAGG
ACTGCCTGCAGCCCCTGAGCATGCAGGCTCTCCCAGCTCAGCCAGAGAGCCTGTGCATCG
TGGAGATGGGCGGCGTGGAGAAGCAGGACGAACTCGGGGAGAAGGCCTCCATCGGCTTCC
TGTACCTCAACATTGGACTCCAGGTACCCCACGGGTGTGACGGTGGCCTGGGTGTTGCTG
TGGGTGTGGGCTCATAGCTGTCCGCTGTCTTCCAGAACGGCGTGCTGCTGAGGACTGTTC
TGGACCCGGTGACCGGCGACCTGTCCGACACCAGAACGCGTTACCTGGGCTCCCGGCCCG
TCAAACTCTTCCGAGTCCGGATGCAGGGACAGGAGGCGGTACGTCTGATGTTCCTGCCTT
TCAGGAGCAGGGTTAGCTGTTAGACTGAGGCGGGTGAGCGTGAGGAATGCCAACGCTCCG
CTCTGCTTCCCACAGGTCCTGGCCATGTCCAGTCGCTCCTGGCTCAGTTACTCCTACCAG
TCCCGCTTTCACCTGACTCCTCTGTCCTACGAAACTCTGGAGTACGCCTCCGGCTTTGCC
TCTGAGCAGTGCCCCGAAGGCATCGTGGCCATTTCCACCAACACGCTGAGGTAGGCGCGT
TTAACCTCGCTGCTCGGCCCAGCCGTGGCCGCGATGCTTCCAGCCCTGTGATTGGCCGCC
TGTGACCACGTGCCTCCTTCCCCCGTCCCTTGTCCCTTCAGGATTTTGGCTCTGGAGAAG
TTGGGCGCCGTCTTCAACCAGGTGGCCTTCCCCCTTCAGTACACCCCCAGGAAGTTTGTC
ATCCACCCTGAGACCAACAACCTGGTTCTGATCGAGAGCGACCACAACGCCTACACGGAG
GCCACCAAAGCGCAGAGGAAGCAGCAGATGGCGGAGGTATGCAGCCCTGGGGGCCAGCAG
CCCTGGGGGCCTCCAGCCCTGGGGGCCTCCAGCCCTGGGGGCCTCCAGCCCTGGCCTGCC
ACGGCTCATCCGCTCTCCGTGTCCTCCGCCGCTGCAGGAGATGGTGGAGGCTGCCGGTGA
GGATGAACGAGAACTGGCCGCCGAGATGGCCGCCGCCTTCCTGAACGAGAATCTCCCCGA
GGCAATTTTCGGCGCTCCGAAAGCCGGGGCCGGGCAGTGGGCCTCGCTGGTGCGGCTGGT
CAACCCCATCCAAGGGTCCACCCTGGATCAGGTGCAGCTGGAGCAGAACGAAGCCGCCTT
CAGGTGAGCCACGCAGCCGGCACTGGGCTGTGTGGGGTCAGAGAGGTCGTGATCCCGAGG
CCAGGCCGGGGATGGGAAAACGCTCCGAACCGCGGTCCGCGACCACAGGCTGAAACCCTG
AGGAATGTGCAGAGCAGCAGATGGGCTCTCGCTGCGCCGCCCTGTTTGTTGAGCCAGGCG
CTGCTGTTGTTTCCTGGCCGCTCTCGGGACTTCTGTGGGCTGTGGTTTGGGTGTTTGGAC
ACATCGGCCCCCCCTGCTCCCCCGCTGAGGTCTGCAGACGAGCTGCAGGTAGCAGTTTGT
CCCTGCAGGAGGTGGCAGGACTTTCCACAGCTCCAGACACTCAGCCGCTCGCCACCTCCT
GTCCCGCGTGCTCCGCGCGATGCTCGTTTGCTGCGTTTTTCTCAGCCATTTGGCAGAAAT
AGAAGTCTTGTGATGGAGATGGGAGCCAACAACCGCAGCCACGCACGCTTTGATGTGAAT
GGATCGATTGTTGTCACTTTCCCTATCCCAATCTGTCATTTTCCTTTCTGTTAGGGTCAT
TTCCTCAATTTTAATCTCGTTAGAAGTAATTTCATTTACAAGAAAGTGCAGCTCTGACAA
ACACACAGCTGAACAGAGAGTTTGCTGAGCGCCGTCTTTCAGCTGGTTCAGGACTCCGCC
GTCTCCTCCGACCATCAGGGGGCGCCGCAGGCCCGGCTCCCAGCAGGACGCTGGGAGAGG
GCGTCCGGGGACGAGCCCTTGTGCCATAGCGGTGTTTGTGAAGATGTGTGTGAGCAGTTG
GCGCCCAGAGTCTGGGCCAGGACTGAGCTGGGCGTGTCGGCTCGCAGTTTGTGTTCTCCC
AGCGGTCGGATGTCCTTGGTCCCGCACCAGTCCTCGTGTGGAGACTGCATCCAGTCCTCG
CGTTCCTGCTCTGGTCTCCAGATGGAGGACGGCTGACCTCTCACTGCCTCTTCTCTCCTC
TCCTCCCCTCAGCGTTGCAGTGTGCCGTTTCCCCAACACGGGGGACGACTGGTACGTCCT
GGTGGGCGTGGCCAGAGACATGATCCTCAACCCCAAGTCTGTGACCGGCGGTTTCATCTA
CACCTATCGGCTGGTCGCCGGCGGGGAGAAACTGGAGTTTGTGCACAAGGTGGGTGCATC
TGCTCAGGCTGTGACCGCACAGATCCCAGCTTTGGGTTGTTTCATCTCTTCATGGAAGAC
CAACACGTTCGTGGAAGAGAGAGAAGAAGAATAGGGGAGGGGCCTCGCATCGTAGATCAC
GCCACATTCCTGAGTGGTTGGATGAGGACGGGCTACAAAGTAGATTTGGGACATACAGAA
CCTCTGTGGATACACTAATCAGTCCTTAATCCACGATGAATGTGACGGTGGACGCGGTTG
ATTCCCGGCGTCTCCAGCTGATAAGAGCCAGCAGGGCCGTGAGGGCACGCGGCTGCGCTC
GGATCCCTCGCAGAGGCCGACCACGCCCCGCGTGTGTCTGCACACGTCCAGGGCCTGGAG
ACGGGGGCCGCCGCAGTGGCTCAGGGTTGGTGTGGACGGGCGGAGGTGAAGCCCCCAGCG
TGACTGGCTACCTGAGGGGGATTACCAGCGGTGACTCGTGGGCAGGACTTTCCCCACCAC
CAAACCACCTCGCCGTCTGGGCCCAGTGTGTCATGTCTGAGCGGACCTTTGTTTGCTCAG
AAGATCACGCCCGGAGTCTGAGAGCTGGTCTGGGGCTGAGCTGACCCAGGGCCTGATGGT
TGTCCCCGTCCAGCCCGTCCAGCCCAGGAGCAAGGCGGAGACGCCGCTGGAGCAGGCAGG
CCCACACCATGCTGGGACGCCTGCTTGAGGCCGCTGGCGCCTGCTAAATGTGCTTTCAGT
TATCCCTGGTGATTTGAATCCACTACTGGACGGGGATCTAGGAACCCCACCCCTCCGACA
CCATCAGGTCAACCCGGAGACGTCTTTATCTTGGAACCTTAAAGCGTTGTTGAGAACGTT
CTAACCCAAACCTACTCTGAGCCCCCAGCCTTGAAACCACTGCCGTTAGAAGCTGCGTCT
CAGCCTTTGATACCCTTCGTGTGTCCTGTGTTTTCCTCGGCAGACCCCGGTGGAGGACGT
CCCTCTGGCTATCGCTCCGTTTCAGGGACGAGTGCTGGTCGGAGTGGGAAAACTGCTGAG
GATTTACGACATGGGCAAGAAGAAGCTGCTCCGCAAGTGTGAGAACAAGGTAGGTGTCCC
ACGGCCTGCTCGTCCCTCCGTCCCACGGCCTGCTCGTCCCTCCGTCCCTCAGTCTGCTCC
TGGGTGCGTCCCTGGCTTGCAGTGGGTGGAGGGACCGACAGAAAAACCAGTATGGTTGAT
AAAAGTCCCCGTTTATTTATTGTGGGACAACTTGAGGACAAAGATGAAAAGCAAGCTCAA
CAAAGGGGCGGTGCAGGCCGTTCTCAAGACACAAAGAAGAAGAGAACAACCGGGAGAGCC
TGATTTTGCACACAAAAGCACGTTTTGAAGAAAAGCCCTCACCGTGTAGGTGTCCTACAG
CGGGTGTCCTACAGCGGGTGTCCTACAGCGGGTGTCCTACAGCGGGTGTCCTACAGCGGG
TGTCCTACAGCGGGTGTCCTACAGGTGTCCAAAGAGCAGCACCTGGGCGCCTGGCTCGCC
CTTCTACACAGCCAGCAAGACGCAGACGGTTTCAGGACGAAGGGACCACTTCCCTGGCCC
ACTGCAACCATGTGGGGCCCTTGGACGGACCCAGTTCCGACCCAGGGCCTCAGCTTGGTC
AGCTGACCGCCTCGGGCGGTCCCATGACAACCAGCAGCCAGCCAATCAGGCAGAGCAGGC
AGGTGCTGAGGACCAGGACCTGGGTGCTGGTTTAGAGACATTTAGGCAGCTTGGAAAAGC
GTCGGTTGGCCTGTGGGGTCAAAGGTCATCGGGCCGAAGCGGTGACGCCGCACGCGGCCC
TGTAGCCGCATCAGCGTGCACGTCGAGGCAGCGGAGCCGTGGCATGATTGGATTCCAGCT
CCGGGCTAATTAGCCAGCCAGCTCCCTCCCCAAGATTTCCTGTCACATGATGCGTGTAGG
AGCCCGGGGCCGCGCCCGGGTCGGGGAGGCAGCTGAGGACGCGTCAGAGCCGCTCCACCT
TTCCTGCTGCCCAGCGTCGCCCCCGTTGGCAGCTGTGACAGAAGGGGCGGAGCCTGGCTG
GCGTCGCGGCGAGCGCTCCTGCAGAGACAGACGGTGCGTTCGCTGCAGCTCAGAAACGGA
AGCGTTGGGGGGGTTGAATCTGAGCGGAAGGGGGTGACGAGGCTCCTGCTCGTGAGCAGA
ACCAGCCGGAAACGAGACGGAATATTCTACCCAGCCAGATGAGAGGCGGCGGCGCCGCTG
GCTGCGCTAACCGTCAGGTGGTTCATGGACCAGGGTTGATTAACCCATGATTAATCCGTC
CATCGTGGACCAGGAACCCTGAAGGACCCCGGACCCCGGACCCCGCTGGCTGCTGGTTTC
CCAGTGCGCGCCTCAGAGGCGGCACCAGCCCGCTTCCTGCTGCCGGGCCTGCCCGCCGAC
CGTCTGGCTCTGGCTCTGGCCCACCTGCTGCTGACGTAGCTGCTCCCTGTCCCCCCAGCA
CATCCCCAACCTGGTGACGGGCATCCACACCACGGGCCAGCGCGTGATCGTGACCGACGT
CCAGGAGAGCCTGTTCTGGGTCCGCTACCGGCGCAACGAGAACCAGCTCATCATCTTCGC
CGACGACACCTACCCGCGCTGGGTGACCACCGCCTGTCTCCTCGACTACGACACCATGGC
CTCGGCCGACAAGTTCGGCAACATCAGCATCGTAAGTACCGGAGGACGGGAGGGCGGCCC
CGGGCCTCCACCCGCCCTCATGCCCTCGGTGGTGTTGGTCCCGCAGGTCCGGCTGCCCCC
AAACACCAGCGACGATGTGGATGAAGATCCCACTGGGAACAAAGCCCTGTGGGACCGAGG
CCTGCTGAACGGAGCCTCTCAGAAGGTACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1212..1367, 1444..1614, 2200..2372, 2464..2605, 2685..2797, 2868..3005, 3103..3206, 3291..3456, 3569..3664, 4107..4179, 4380..4531, 4606..4761, 4871..5026, 5339..5482, 5555..5677, 5775..5929, 6041..6215, 6337..6542, 7512..7668, 8623..8748, 10138..10350, 10426..10524
1001..1070, 1212..1367, 1444..1614, 2200..2372, 2464..2605, 2685..2797, 2868..3005, 3103..3206, 3291..3456, 3569..3664, 4107..4179, 4380..4531, 4606..4761, 4871..5026, 5339..5482, 5555..5677, 5775..5929, 6041..6215, 6337..6542, 7512..7668, 8623..8748, 10138..10350, 10426..10524
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved