Tetraodon_nigroviridis Locus eif4g1a
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis eif4g1a
Tetraodon_nigroviridis
eif4g1a
Un
SNORD66
7618..7694
12347
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCTCTCTCCACGGTGCTCCTC
TCACCTCCCAGCGCTACCCTGGTGAGTAGTGTGTACCTGCGCTTGTGTGTCGTTCAGCGG
GCTTCAGTGGCAACAATGACTGGCTAATTTTGGCTGGTACTTTTTTTTTTCCCCCCAGGG
TAAACTTCCACATTGATATTTGAAACTGCTCATTCACACAAGAAGGGAAAGACTTAGAAA
CATTGAATAGTTTCTAAATCAGCTGAAATGTCTATTTCCAGGTGTAATATTTTGGTTACA
TTTAGGTATGCTGAAGTGTGCACGCACTCTACGTTTTTGTTAACAAGATAAAACATTTGC
CTGCTACTAATATTTAACAATGTTTGACACTCATTGTTTACAGCTTGTACATCTTGGCTG
GACTTAGCGCAGTAATTTCCGAGCACTTTTATTTGTATTAAGGTTCAGATCACCAATGAC
AAGTGAAAAGTGCAGAGGAATTCAGACGAACGAACTGTAATTTGTAACATGGGGGAATTT
CTCATAAATCCTTGATTGATGGAAAGTTTGATTTCTTTTTAGCTGCAGCCTACTACCCAG
CGCAGCCCCAGTACTCGGCATCTGTTCAGCCTGCGCCAGTTATGATCAACCCAGCCCAGC
AGCAGCAACAAGCCCCACCTCCCCAGCAACCACCAGCACAGTCACAAGGCCCACCAAAGA
GGGAACGCAAACCGGTAATGTCCCAACAATGGGGCAGCATGCCTCTTGTCCGAGGTCTGA
AACAAATGAATGGACAGAAAGCATTTGTCTGGTCAATCCAGAACTTTCTCTGAGCCTGAA
CAAAACAGTGGTTTTTATTATGAGGTTTGGCAGCTGGAGATAAGAAGTTATATGATTATT
GAACACCATTGGGGTTAATCGTTGGTCAGCCATGTCAGAGTATTGTATCCTATATTTTTA
TTCAAATAGATAAGAATACGAGACCCTAACCAGGGTGGGCGTGACATTACAGAGGAGATA
ATGTCAGGTGGAAGGTCCGCTACCACACCAACTCCTCCACAGGTACGAAAGCTTTTGGTG
CCAATTTCTATTGCTTGGTTAAACAAATCTAAACCAAGCGTAGTTTTTACTAACAGCCGT
AAAAGCTTTTGAATTTTACCTAAAACCTTTTTGGTACGTTATATTTTATATGTCCATTAA
AGGTTAAAAATCTTTGCTTAAGATAAATCTGTTTTTTCTTTATTTAAGTTGCACAACACA
AAATGCACCGATGTGGTGTGTTAAAGACTGAGATGGCCTCATCCTCCAAATATCTGAATT
TCTTTTTTGGTATAGCTAAAAATATTGTACATTTTTAAACAAAAGCATTAATCTGACCCA
AGTATTCTGTGACTCCAGGTCTCTGTCTCAGATGTAAATCCTGCACACATCAATGGAGAA
AGTACACATCTTGTCAACATGGGAACAAGAAGAGGTAATTAAACATCCTTAGTTATAGTT
TACTGCAGAGATCTAATAGTTATCCCTGTAGCTATGTATAATACTATCACCTCAGTCAAT
GAGGTTAGAATAAAACAACCTACCATGTAACCTTACATTATGACTGCCTCCAGATCTTTC
AAAGGACCTTGATGCACTAATGGGAATCATAATATAAAATCTGCCACCTCAACCAGCAAA
CTTTTACCGATGCTACCTCTTGAATACAAGGCTAGTACAGTGGCAGACAAACTCGTTAAA
GTTGTTTGATGTAATTGTATTCATTTTAGGTGCAAATCACAATAAGTGGTGAAATGTGCT
GCTTGGCAGAGGTCTGCACTCTCAAGAGAATTTTTTGTTGTTATTATTACTATGATTGTT
AAGGAAATCTATAATCACACTGCCTCCTGAGTTGGCTGCTCATTCTTTAGCATCTGCTAC
TGATGTGGATTCTTCGTTGATAAAGGATGAGCAGAGTCCTTTTTCTCTTCCTCCAGCTGT
GGCATCTGCAACACCACCTACTGAGGCAATAAACCAAGTTGAGGCTAAAATTAGTGACAC
TGTCGACGCTCCTGTTCCTTCTGCATCACAAACAAAGGAGGAGGCACCCGTTAAGACAGA
AGAACTTGATTCCTGCCCTGATGAGAAGGAAATGGGTGAAAAGAAGGGAGATGAAGTGCA
ACCATTAGAAGATGTGGTCAGTGCTAAGTTAGAAGTGGCAGTTGAGGATACTGATAAAGC
AAACCCTGTTAACATGGAAAACGAAGAAACGATTGCAGAGCAACTAGCGGCCGAAACCTC
TGAGCTTCCACCATCTGAACAGGAACCTGCTGCTCCACAGAACCAGAGTGTCATCCTAAA
CTCTGAACCTGAAACAAAATCTACATCAGATGAAACTCCAGAGTTGCCTCTTGCCAACGG
CCTTCCAATGGAAATTGAGGAACTCCCCGATTTGTCCTGTTCAGACACTACACCGCTGGA
TAAGCCTGATACTATTCATTCTCAGGAACCTGAGTCTGGGGCTAATACAGCAACCCAGGA
GGAGATGGCAAAAGAGGAAGAAAAGATGAAGCCCAGTAAAGACGATCCTCCCTCCACTGT
TCACTCCTCTGCAGACGACTCTACTACTATGCAACGTAAAATGAACTTGATTTACATCTT
TAATTTTAAAGTTTGTTTCTCTTTTCTATGTAATCATACGCACCTATCTTCTCAGCTGCT
ACATCTGTGCCAAAGAAGAAGAAAAACATGAAGGAGTTCAACAAAAAGGAGGCCATTGGA
GACCTCTTAGATGCCTTCACTGAGGTGTTTTAGCCATCTGGAGAAGTTAAAATGTCTCAT
CGTTTTTAGCTGATCTTTAACATTTTTTTTTTTGTTTCCCTTTAGGAGCAGATAAATAAA
CCTGCTGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATACGTCATAAATCCCCCACCACTATCAGGAATTTAAAAAATACTAAACTTT
ACACCTTTTTGCACCTTTTTTTAAATTTTATTTTAGAAGAAGAAGATAAGGCAAATGACC
AAGATGGTCACAACAAGCGGTACAACAGAGATTTCCTTTTGGGTTGCCAGTTTGTTTGTG
CCAGTATGCACAGACCAGAAGGCCTTCCTGCTATCAGCGATGTGGTCCTGGACAAGGTAA
GAATTTGACATAATTTTAAAATAAAAGTTGGATATGATGATCTTTTCTAAGATAATTTGA
TAATTTAGAATTTATTTTTTTTTTTTTTTTAGGTGAACAAGACTCCCCTGCGTCCTGCTG
ACCCAGCGAGACTGATGAATGTTGGTCCGGATTTTACACCCTCATACTTGGGGAACCTTG
GAAGCCGATCAGTAGGAGGACCACGAGGGCCAGTGAGTACATTTTTTTTTTAATGTAACA
TAAAAGCCTTTCATATATATATATATATTTTTTTTTTTTTGTTTGTTTGTTTGTTTGTTT
GTTTGCTTACATTTCAAACTCTTTTTTTTTTTACAGCCACCAGGGCCACGACGCTCTCAG
CAGGGTCAGAGAAAAGAGCCAAGGAAAATCATTAGTAGCATGTCCTTAAATGATGATGTT
CAACTCAAAAAAGCAGAGAATGCCTGGAAACCCTCAAACATGAAGTCTACAACTCATGAA
GAAGACGAACAGTCAAAGACTCAAGAGGTCTTCAAGCAGCTTCGTAGTATACTGAACAAA
CTGACTCCTCAGAAGTTTCAGGCTCTGATTCAGCAGGTGAAAGAGCTGAAGGTAGACACA
GAGGAGAGACTGAAGGGAGTCATTGACTCCTGAAGCATGAAATCTTTGAGAAAAAACAGA
AAGCGTTGGATGCTGCCAAAGATGTAAGTATGTTTCACTTTGCTTGTACCAACCGCATAG
TTTATAGGTGCTGATTTTTTTATTTTTTTTTCAATTCCCTATTCACGCGTCCTTGTATTT
ACCTCAGGGAGATGAGCATGAGAGGTTGAAGTTGGAGCTGGAGGAGGCCAAAGACCAGGC
ACGGCGTCGTTCACTAGGCAACATGAGGTTCATTGGCGAGCTTTTTAAACTGAAAATGTT
GACAGAAGCTATTATGCACGACTGTGTGGTAAAACTGCTGAAGAATCATCACGACGAAGA
ATCTCTGGAGTGTCTTTGTAGGCTGCTCTCCACCATTGGTAAAGACCTGGACTTTGAAAA
GGCTAAGGTAATAAACGCATTTACAGCCACTGATTGTTTTCTACTTTCAAATGTTTTTGG
AAAATAATGTGCTTACTGTACTTTTAGAGATTGTTGTAATCATGTTTACATCTTTACAGC
CTCGAATGGATCAGTACTTCAATCAGATGGACAAAATCATCAAAGAGAGAAAGACTTCTT
CCAGAATCCGATTTATGCTACAAGATGTGCTGGACCTCAGAACGGTAAAAAAAAAAAAAA
AAAATTAAGACTTTAAACAGCTAGTTGTAACATACCCTTGATTTATCTGTTGCACAAAAT
GCCAGCCTTTTTATTGGAAAAGTACGGTCTAATTATCTTCCAACTGTGATCATCAGAATA
ACTGGGTGCCTCGTCGAGCAGACCAGGGTCCTAAAACAATTGACCAGATCCACAAGGAGG
CTGAAATGGAGGAACAGAGGGAGCACATTAAAGTCCAACACCACCTCCTATCCAAGAAGG
ATGGAGGAGGCAGGATGGGAGGGGGCATGGGAGGCCGGGGTCCTCATGCACAAGGAGGTG
GCAGGACTAGCCAGCCTCAGGACGAAGGATGGAACACGGTGCCTATCTCCAAGAATAGAC
CCATCGACGCTACACGCTTTAGCAGAATTACCAAGGTAGCTGTTAAATCTGTTAAGATCT
TCAACACAAGTTGCTTAATAGTTTTAAAAAAAAATGATTCTCACTATTAAGCTTTTTTGA
ATGCAATTATGTAACTTGTGCCTCGAGTAAGTGACTTTAGAATACTTTATTATAATATGT
CGATATATGTGTTTTGCTTCAGCCCGGTGCTGTGGACATCAGCAATCAACTCTTAGCCCC
AGGGGGCAAAGGCACATGGGGGAGTTGGGGCAAAGGTAGCAGTGGAGGAAGTGGAGCAAA
ACCAGCAAGTGGAGAACAAGGTAAAATGTCAGATTAGTATCTAGTAAACTCCTGTTTGCT
CCAATACTGACTGGTGTGTGGTGCCACGCCTCTAGGCCTCAGAATTACCCTGATGGTTTT
GAGGAACTAATGGCATCATTGGATTAACTAACTTTTGTTTTCCTAGTAGTTTACCCTTTT
TTGTGGTTGTTGTTTTTTTTAGATTCTAACCGGTCAACAACCAGCACCCTTAACCGCTTC
TCAGCTCTGCAACAGTCTGGTTCATTGTTATCGTCAGCTGACTCTGATCGCCGAGTTCCT
CACAGGTATATAACAGTTGCAAACATTATCAAAAAAAATGACAACAATCATGAGCCCTAA
ATATGTCGGGTTGTGAGTGTAATATACATTTTGACCTATGTATTTTTATTTTTTAGATCA
AGCTCCAGTCATGAGCGTGACAGAGGGGAAAGTGACAGGGATCGCTTCGATCGATTTGAT
CGCAACGAGGGTCGACAAGGCAGAGATGACAGGGACAGTCAGAACCAACTTACCAAGAGA
AGCTTTAGCAGAGAGTCTCAGGATCGCGGCAGCAGGGGTAGAGACAGGATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAATGTAGGAGGCGATACAGTGTGTCACAGAGCTCAACAGTGCCT
CATTGCTTTTTGTGTTCGTACGGTGTGGCATTGAGTACACTCTTGAACGTAGCACCCTCG
TCAGAGAACATCTGGGGAGATTACTGCACAACCTTGTGAAGGGTGGAATATTGCCCACAC
AGCAGTACTATAAAGGGTAAGCATGTAAAAAATTAATCTAGAGTACACTGTTTCCAGTTT
GTAGAGCACCATTTATGAGTCCTTGATTGGTCAAATCTGAAATGGTAAAGTGAAAAGAGG
ATGGCTTTTTGTCTTTAGGCTAGAAGAAACTCTGGAGGCTGCAGAGGACATCGCCATTGA
TATACCTCATATCTGGCTTTATCTGGCAGAACTGATTACCCCCATGCTCCATGAGGGTGG
TATCCCTATGGGACAGCTCTTCAGGTTGTTGTTCTTTTTGTTTCTTTGTTTGTTTGTTTT
TTTAAATACAAGGGTTTATATTGTATTTGGTTGACTGACTGACTTTTTGTGCTAACAACT
CTCTTAATTATGCTATATAAGCATCTTTGATAAATGTTAACATTTTTTGTCTGCTGCACT
ACATATAGATTCACAGTCGATGGCGCTGGAGTGAATTTTGGTAGAAAAAATCTTTCTAGA
CAACTAATTGGGTTCAATGTTACTGTAGGGAGATCTCAAAACCTCTTGTGCCTCTGGGGA
AAGCTGGTTTGCTGCTAGTGAAGATCCTGAAGTTGCTCTGCAAAGGAATGGTATGTTCAG
CACTTCCACTTTGAATGTAAACAATTCCAGAACCTATTGAATTTTAAAGGCAGTTGTAGC
AAGTGTATTTTCATTTCCTTTAGACTCCTAAAAAGGTTGGGGCCATGTGGGCTGATGCTC
AGCTGAACTGGAATGATTTCCTGCCTGAGGATCAAGACATGAACAAGTTTGTCACTGAAC
AGGTGAGCAGTATTACTGTAGGGAATAGACTCATCTACTCAGTGGTATAAAGTCAACTAG
AAATCAGGGGAAAAAATGGTCTCCCAGTACTAAACTAAAAAAAAATATAGAACAAAGTGA
ATGCACTAAAAGTAACTTTTCCTTAGGAGGTTGAATTTACAATGGGAGAGGAGTCCAAGT
CAACAGAAGTTTGTAAGAAAGTCCTGAGTGGAGCACAGCTCATCGAAGAGCTGGACAGAC
TCCTGGAGGACAAGGCCAGCGACCAACGGATCATTGACTGGGTGGAGGTCTGAATCTACC
ACTCATATATTCCATCAAGAGTTCATTATTCAATTACAATATGCATAACAAACTGACAGA
ATGTATATGTTTTTTTAGGCCAACTTGGATGAAGCACAAACAACATCTAACCAGTTTATA
AGAGCCTTGATGACGTCTGTGTGTCAGGCCGCTATTATTTGTAAGTGTAGCCGTCAGAAT
GTCCCATCGAGTCTAATGATGAATCACGTTTGACTGAGCTTGCAGCCCTTGAAAGTACTT
GTGTCTCATCTCATGGTCGGGTCTCACCTGAACTCGGTCCGTTTTTACTGCTCTCCTCAG
GTGAAAACCCGTACAAGATGAACTCCCTGCAGATTATCAAGAGAGCCAGTCTGCTGCAGA
AATACCTGTGTGATGAGCAGAAGGAGCTTCAGGCCCTGTTCGCCCTCCAGGCTCTCATGG
TGCACATGGAGCAGCCAGCAAGTGAGTCTGCTCTTACCTATCTGCCGTTGAGTCGGTGTC
TAGATTTACCCAGGTAGCTGTTCAATGATTTTTGTTCATTATTTTTAAAAATATGCTTTA
AAAAGTAATTAAGCTACATTTTTTATTGTTCTTTCAGTGGTTTTAAATACTTCCGACGCC
ATTTTAAACTTGGTGTAGGATATAAGAATAAATGTGGGTCCAAATTATTTCAGTTGCCTG
AAGAGAGAAAGTGCTATCTTTTTTTAAATTTTCAGTCATACATTGTCTCCCTCTGCTTCT
GTTGTGCTGAAATGAGGTCACCTTGTTAAGGCGAGTCTTGAAGTTTAAAACTGAATTGAG
GTTAAAGAAGAGATATTATCGAGTGATGTAATTATCTCAGAATATTATATAATATTCCAA
TTAATCTTTTAGTGGCTGAACTTAAAACAGTTTCATCGATGACATAAAGTTTTTGTTATA
CAAGAACATCACGCTTTAGTTTTATAAATGCTCAGAAAAATACCTGTGTTCTGTACCCTT
GCTGCGCAGACCTGCTGCGAATGTTCTTCGACACCTTGTACGATGAGGATATCATCAAGG
AAGAGGCCTTTTACAAATGGGAGTCTAGCAAAGACCCTGCAGAGCAAACGGGGAAAGGTG
TGGCCTTGAAGTCAGTCACCGCCTTCTTCACCTGGCTGCGCGAGGCCGAGGAAGAGTCTG
ACAAGGAACCGGACCTGACTGAGAGCATCCCCCCTCCCTCTGGGCAATGGAAGGGTCCTT
CAGGGGTGCAGATACAGACGATATCGCCATAGAGAGGAAGACTCAATCAAGCCTCAATGA
GGACGACTCTTTCTTGTCTTTATCTTTGAGGGATAGACTCCAACACTCATCTCTCAATTG
CCCTCTCCCTTATTTCCTCAATATTTCAAAACCTCCGTGTGACCGTAAAGGGTGTCCTCA
ACCGATAAGCTTGAATTCAGCAGGTTTGCTCGTTAACGAGGTGCAACGCGTCCCTCGTCA
CTACAAAACTTTTCGTTGTCACAATAATTACAAAACCAGCAGGCTGCTTCTTATTTTTGT
AATGGTTCTAGATGATGTTGAAGCCTGCCCTCTGGTCTGTGAGCGTGACCAGCAGAGCAT
CTGACCTGGTGGGATTCCTGAGCGTTGTGCTCCGCCCACATACGTTGAATCTAACCTTTG
ACCTTTACTGAAGCGTCTAGCACAGCTGAAACGCTTCTGTCAATTGATCAGTGGGCCAGT
AGACACACACATGAACTTGTAGTCATTTGATGGAGTTTTTAAAGCAGGATTTGTTTATTT
TCTCCTTCCGTTTCCCATTGTGAAACCTAAAGGATGAAACAACTGAAGAGTGATGTTGAC
CTTTGACCTTGACTACTTGGGGATGGTCTCAATGCTTCCTTAAAGCCATCCTCTCCATCC
TCAGTAGTGAACCAAAAGGAGGGACTCATCATCTTTACCTCTAACTGAACCTGAGCTGGC
ATGGAGAATAAGTAATGACCCAATCATCAGTAAAACTTGAAGTCTACAGAAAATCGACTT
GATTATATATTAAAAAAAAAAAAAAAAAAAGAAAGTAAAAAAACACAAAACAGAAATGAT
CCGAAAGCCTTTTCTACTACAAGTGGAAACACATTTCAGGACCTTTCTGTAAATATATAT
TGCAAAACCTTTTTTTTTTTTTCTTTAGTTTTATTTTTCAGAATTATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1153, 1389..1538, 1951..1982, 2075..2155, 2283..3034, 3115..3201, 3283..3309, 5409..5635, 5732..5851, 5976..6322, 6427..6666, 6779..6883, 7016..7294, 7462..7579, 7762..7864, 7976..8146, 8962..9135, 9258..9383, 9628..9709, 9803..9901, 10046..10186, 10278..10359, 10500..10640, 11169..11347
1001..1153, 1389..1538, 1951..1982, 2075..2155, 2283..3034, 3115..3201, 3283..3309, 5409..5635, 5732..5851, 5976..6322, 6427..6666, 6779..6883, 7016..7294, 7462..7579, 7762..7864, 7976..8146, 8962..9135, 9258..9383, 9628..9709, 9803..9901, 10046..10186, 10278..10359, 10500..10640, 11169..11347
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved