Tetraodon_nigroviridis Locus Poly:snoR38
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:snoR38
Tetraodon_nigroviridis
Poly:snoR38
Un
SNORD49
1764..1837
3070
CACAAAACACAGCCCCACACACACAAACAAAGTTTACGTTTAAAACCCACAGCGACGAC
CCGCGGGTGCCGTGTAACCAGGGGTTTTCTGACTCACCGTCTCTCCGGGGCGCCTGCAGC
GCCGAAGCCTCTCTGATGGACCGAGCCCACATCTCCGCCTCCCGCAGGTTCGCCACCGGG
TCCTGGACCAGCGCGACCCGAAAGCACTGTTCCACCCTCTGCCGGGCCACCCCGGCGCTC
ATCCACCGCCTCTTGAACGGGTAGAAATAGGCTGTGAAGTAGGCCCCGACGTCCGCGCCG
TCCGGCCCTTTGTGCGCCCGGCAGCCGACGCAGTCCGTCAGGTGGAAGACTACCCTGGTC
CGGCCGGGTGAGGAGGAGATCTTCTGGATGGTCAGGGCGCTCTCCGTCAGGCTGACCGAG
TACCGGACCCGGTCGTTCAGCATGTCGGTAAACTCCCCGTACAACACGCCCACCGGGCCG
TTCCGGTGTCGGGACGGGTCCGGTTCCGATGCGTCTTTCTCCATCCCGGACGGAGAGAGC
GCGGCGCGTCCCGCAGGCCGGTGTGCGGATGGCGGAGCGCTGCGAGCCTGTGACGGTTGG
CCGTGGGACCCTTCGAGCGTCTTATCTTTCCTAGTCCAGAGTCTCTCCCTAGTGACTGAA
AGAGGGAATGGCAGCGTGGAGGAGCGGCGCTCTCTGCCCCTGCAGCACCTCTGCGCTCCG
GCTTTGACCCCAGGTGGCGTCACCTATTTAACTGATTAAAAAGTTAAACCCGCCAAGGTT
TCTCACCCCACAAATCCGGCAAAACATTTCTCCCATTTTCTGTTAGATTCAATCTACTAT
AGTCGAAGTAAAAGAAGACCAAGTTTTGCAAATATAATCTGATCCCACTCTGATAGTACC
AGACATTTGAACCTAAAATAAAGCATCGGCGGGTTTTACGCCCGCTCAGTCAGCAATTCA
TATTCATGCATAAGAAAATATCTTAGCTTGCCTTTTAACCTAAACAGTAGCCTAAAAGTC
AGATTTGTAATCAAAGTATATTTTGGTACGATAAATGAATAAGTAAAGCTTATTAAATAT
TCTGGTTTCGACGCGAGAGCCACGCCCATACCTGTCACGTGAGGTGTGACGTAGCCTCTA
CATATCCGCCGATCTGCCGAACTTCCTCCCTCGCGCCCTGTGGCTGCCAGCGTAAAGGTT
GTTCGTGAAAACGCTCCAATATGATGCTTTTACACTCTGAGATACTGTTATTCATCGATC
TGGATTTGACTACAAACGAGCCACCATGAACAGGTAATTTGATCTACAGTTACAGCAATG
TTGAAATTACTAAGGTGGTGTTCGATTTCAAGTAATATGCGAGCCTATTAGCTGTTAGCC
ACAGCTAAGGCTAGCCAGCACGTGTTGAAAGACCATGCCAGACTGACTGAAAAATTCTAA
TTTTGTTTTACAGGCGACCCGATTGACGTGATTACTGATCAGCCCTGCTCAGAATAATGA
TGCAAACACAAGGTGACCTAGCCGATTGGCTGCCTGCTTTACCTTCACTGGTTTCAGTGC
ATATGATGATTTTGTTATCCCTGTCTGAACTAATTGTGGACATAATGGTATCTGATCTGC
AAAGTACCGTGAGTGGTAGTGTATTTAAGTGGTAGTTTACATACACTAAAGAAACGTTTT
GTTGTAGGTGGATCTTCCAATTTGCGTGTGGATGAGCGTCATCGTGTTAAGGTTTGGAGC
AGCGTGTTTGGGATTTCAGTTGATTTCCGTGATGAAAAGTGCTACATAGGAAGTGCCGTC
TGACACGATAACTGACGATGGCCAAAGCTGTTCTGAGAAATGCATGAACCCTTTTCTTTT
TCTGCACTTTCGATTTGGTTGCGCGATTAACACGCATGTATCCCTGCAGGTGTTGACCTC
TGCAAAGGCAAAAACTCAAGAAGGCACATTGTTGAAATGAGAAGAACAGGTAAATGATGC
AAAACCTGCTCCCTAAAACAATGTAGCCAATGATGATACAAGTTATCCCTGTCTGAACTG
AAGTGTGGAGTTGTGGTAACCTGAGGCTCAGGTGTGGAGACTCAAGGACTGTGAGGTTTG
TTAACCTTGTAAGCAACACCTTTACTTCTGACTTTCAGGTGAACTATGGCGAAGTGGACA
CAGGCTTAATCCAGAAGACTGATGCCACCACGTACATTAAAAGCACCGATAAACAAACCT
GCAGTGCTACATTAGCTAATTCAGTGATGGCCTGAATGAGCACGCGTTCTCTCTAAATTC
TGCATGAAGATCTCCTCCTCTTGAAGGTGTTCTTGATCCTGGGGGCAAAAGGAATTTTAG
GTCAGGCATGACAAATGCTTAATAAAAAGATTTACACACGAGTCATGTGTAATGTGTCAC
CTCTGTTTCAGTTACTCATGTTTCATGTGAAGACAAATTCAGTTTAAATGTGTCAATTGC
TCATAACAAGCATTTACCTGCATCCAGAGGCACAAATCAGATATGACTAAATATCTGATT
GAGGGACGTAGAACGCCTTTAAATCATTTCTATTATCAAATGTTTCTATGTTTAGTGTTT
TAACCACTCCATACATCTACGTGACTAACTGAACACGAAGTCAGTAACTATGAAGTACAT
GTAGGTATGGAGTGTGAGGAGTTAGTGATTACCTTATGTGCCATGTACCTCCACAAAGCC
ACAAACGCATCATCCACATTGGAAGGTGGGCACACGGGTTTTGGCAATGTTGAATACAGA
TCTGCAGATAGAAAGTGACTTTCTTCATGTTACTCTTATTTATAGGAAGTAATTGTGTTG
TTATCCGCTCTAACCTGGCAGAATGGGTGGTTCCACCTGAGCTACAGATGTGAGTGGAGG
ATAAGTTCTCCGCTGCTCTGTCCCCTTCTGCACTCGACTGATCCTCATATGCTCCTGTGT
GTCAGAGGGGTTTCTGTTAAATAGCTGCTGACGCCAGTGAGGCCTGATCCAGTTCCTCCC
CTGGCTGAAATGGCGCTCACCTGCAGGACATGCTGTTCCCGCTTCCACGGCAGCTCTTTC
TGCCCGAGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved