Tetraodon_nigroviridis Locus ENSTNIG00000004408.1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ENSTNIG00000004408.1
Tetraodon_nigroviridis
ENSTNIG00000004408.1
Un
SNORD10
1298..1436
4363
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAAACTGGTAATTCTTCAAAAGTGCAACAAAAGCTG
TCAGATGTGATCGCACTGGGATTATCTCATATAAATCACAGGGCAGGTTTTCTTTTCCTT
TTTTTTTTTTTTTTTTTTTTACATTTGTAGTTTTGTTTTAAATCCACAAGGTGGTGTTGG
CACTTGGTGACTACTTAAAGTGTACCGCTCATGCGTGTATTGGTGGGACCGGCGTTCGCA
CTGATATACAGACGCTGCAGTCCGTAGTCCCTCAGGTTGTAGTGGGGACCCCTGGCCGCG
TTTTCGACATGTTGAGTCGCCAATGCTTGTGTAAGTTTGCATGCTGTCAAATTCATCCAA
TTTTGTAACACCTTGTGTCTCCATAAACAAGTCAACCATGTCCACAATGTCGCATAGATG
AAGTGTCTGACATCTTCTCTTTGCGATTAATAACTGCTGTATTGGGATGAAACCCATGCG
TGTCAACTGAGTCTCTAAATCTCTTGTCGTGGTGTCGACCCAGCTGGCGTTTTGCAAGCT
TGACTCGACAGCGAAGCAAGGCCTTAGAGAAATGATCAGGACTGACTTTCTGAATGCAGC
ATAATTCACACATATCTATTACCAACAAGTCAAAGTATTGTTTTTGATCTCAAATGCCAC
AATTTTTTATTTAACATTGCAACAATAAATATAAAAATATCTGTTTTTTTCCAAAGTTGT
GGAGCACAAGTTCATACATACAACACAGAAATGCTTTTATATATTTTTTTACAGTTTTTG
TTTGCAAAAGGCGATGTCACAGTATTGTGAGTTGTCTTTTCAGATCCTGAAGGCATTAAA
ATGTTTGTGCTGGATGAAGCCGATGAGATGTTAAGTCGTGGGTTCAAGGACCAGATCTAC
GATATCTTTAGAAAACTTCCCACTGATATACAGGTAACAGTTGTATTTTTGTACTTTGCC
ATCTCACAGACGAACATGTAACTGTAGGTTAGATATCTGTGTAATGATTAATAAAGAAGA
ATCTACACAGTAACTATTTCTTCTCCCTCGAAGGTTGTTCTGCTGTCAGCCACCTTGCCC
ATGGATGTTTTGGAGGTCACTAAGAAGTTTATGCGTGACGCTATCCGCATTCTAGTAAAG
AGGGAGGAGCTGAGTCTGGAGGGAATCAAACAATTTTACATCAATGTCCAGAAAGAGGTG
TGAGGATTTATTTGGTCACCAAACGAGTATGCCAGGCAAATATTAGGATTGATAGCAGTT
TAAAAGTCAGGACATCATTGTGGACTTGCGTTGATGTCTCATTATCTCAGTGAAGTCATA
CAGATGTATAGTAGAAACTCGGATTAAGAATGTAATTTGCCCAGATGTTGGCTGCTGCCA
GTGCTTCACGTAAGGTAAATGTTCTTGCTGTGGCTGTTAGGAGTGGAAGCTGCCCACGCT
GTGCGACCTGTACGAGACCCTGACCATCACTCAAGCTGTCATTTTTGTCAACACAAGGAG
GAAAGTTGACTGGCTTACTGAGAATTTGCTGGGCAAGGACTTTACCGTTTCAGCTATGGT
ACCTTTTTATTAGGTTTAAACTTTTTTTTTTTACTTTTGTCGGTCTGCTTTAAAGGCTTT
ATCGGTGTGTATTCCACTTTGCTGTGTCTGACCTTTTTTATTTTCCAATTTTTAGCACGG
TGACATGGAGCAAAAGACCAGGGACCTAGTCATGAAGGAGTTCCGCTCTGGTTCCAGTCG
AATCCTTATAACCACCGACCTGCTTGTGCGTACAGTATTTATGTCTAGACTGCATCCTAT
ATAGTTGGTTACATGCTGTACTTGTGTCTTGCATTAGTTTTTTTCCAATTTTCTCTTTCC
GCCTATCTGCTGTGTTAGCAAAGGACTGAAAGTTCCTTGGTAGAAAAATCTATCTGTATT
TCACCATGGCTTTGGTTAAGTCATCAAGTCTGATTTGCAGATGGTATTGAATTGTTCATA
AAAAATTTAAAATCGTGTGAGGTGTGGTGAAAAGAGAATTTGGCGAGTCATCACTGAGTA
AAACGTTTCCATTCTCCCCAGGCCAGAGGTATTGATGTCCAGCAGGTGTCTTTGGTTATA
AACTATGACCTTCCAGCTAATAGAGAGAACTATATCCCACAGGGTAAAAAAGGTAGTATT
CTTTAATTATTTTTTTTCGAATACAGATTACCCGCATAACCCGATTAACATGTTTTGTTT
TGTTTTGTGTTTTTTGACGGGGTAAAAATGTCATGTGCTATGCAAACACTAACATTAAAC
AGTTGCTTAGAATCTTAGGATAGAGGATAAAAGGATAAAATTAAATTAGATCATCATATA
ATAGTCTTATTTAATGATTTTATTTTTTTTCTTTTCCAGGATTGGTCGAAGCGGCCGATT
TGGTAGAAAGGGGGTGTCCATCAATTTGATCACCACTGAGGACCAAAGGACCATGAACGA
TATCGAGGCGTTTTACAACACCTCCATTGAGGAGATGCCAATGAATATTGCCGATCTTAT
TTAGAGTGACCCACATTCTGTTACGATGGTGCTTATTTAGGAATTGCAGTTGTGGGTTGT
CCTTTAAAAACACTATTTTCATGCCCTACATTTATATTCGAAACGAAAGTTTTACCTATC
GCTATTTGCGGGTTTTTAAACGGATACTAAGCGTAAAGCGTTCTTGTTGCAGTTGTTTGC
AAAACCTGTGTGTATGGGACACAGGCAGTTGTAAATACAGGTCGGGGAAGGTTTGTTTCT
GCAACGTTATAGATTCCTGGTCAATCTGGACATGTGATTTAACCCAGGCCCACAAGGCCA
CAATCTAGCGGCTTTCACCTAGAAAATTGGCATCCAGGGTGGGAATCCACATCCAGGGAA
GCACTGCTGTGCCTAACATTCCACTAAGTACTGAATTGCATATTTGGATTGAACAAATTT
TGTGCATTAGAATTCAGTCAACAATTCCAATGATTTGGACCTCGATTTTGGGTTGAATTG
CTGTGAAAACTTCACCGCTGCCTTTTTAACCTGGTGACATTTTAACGTTGCCTTTTTTTA
TTTTTTTTGATCGATTATTGATAAGGTGCCTTTTTCTTTGACCTACTTCATGAAAATGCA
GAGCATGTATAAGATATTCGAGGACCACATTATAGGTGCAAGCAAGTTGTGCTCTGCATT
TAACTTGAGCATTATTTGACTAAGCTTGTTTGGTTTTGGAGAACTGAGGGCTTGTAAAAC
TGGTGCTACTTGTTTGTTTCCTAAAAGCTAATTTTTGAGGGAGGGATCTTATGGAATGTT
TTTACTGTTTCACACTGTATTCTATTTATTTCAATAGTCTAAAAAAATAAATACTTTTTG
GGGGAAAATGTGTTGGGAGATGTACAATTTTTATTTTATTTTTTTTACATTAACGTTCTC
AAGACACAGAAGCAACCCTGCCAGACAGTTCATTTATTTGCTCTTCAAAATACTTTAATT
TCAGATGCCAAAGAAAATTCTGAAAAGTCACAAAACCATTGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1169, 1663..1772, 1893..2036, 2256..2397, 2515..2604, 2901..2982, 3218..3363
1001..1169, 1663..1772, 1893..2036, 2256..2397, 2515..2604, 2901..2982, 3218..3363
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved