Tetraodon_nigroviridis Locus rpl10
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl10
Tetraodon_nigroviridis
rpl10
Un
SNORA70
1924..2056
4116
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGGTGACGAGACTCAGACAAAAAAGCAAAGGCAGATGTTTGAGAGAGGA
GTCAGGGCTGATGTCTGACCTCCACATGAGGCTGAACAGACGTCAGAGACCCAGATGGAT
CTGCTTGACCTTCCAGCAGGAGGAACGCTGGGACGTTCTGGTTTAGAAAGCAGCATTTAA
AATAATTGTTTTCTCTGATAATAAAGCTCACATTTAGCAAACTCCAAGGATTCCTCACAT
TCTTTGTGTTATCAAAGTCTAGGAGTTTGGTCTCTGTGTGCAGGCTGATTTTTGCTGAAG
ACAGTTTTTGCTTTTCTGTGCAGAAGTTGAAAAAGGTTTTTTTTTTAATTGTAGCTTTTT
TGATTCCCCCCCCCCATCCGCTCACGTTCTGCTCTGTTTACTGAGGCTGGGACAACTGGT
GCATTGGCAGATGTGGCCAGATGTGAACACAAACAGCGGCTAATTCAGAGACATCAGAAT
AAAAGCTGAGTTGCTGTCAGAACAAGGTTTCTTGAGCTCCCTTTTCACTCTAACAGTAAC
GTTCACCGCACATTCTCCCATACGTTGGTTTGTCCGCTTTGCTTTTATATGTGGTTTAAC
TGTTTTATTTATGTTTTAACTGTTTTGTGAGTGGTTTAACTGCTCTTGGGGTCGGGGCAG
GAGCAACAACAGAACATAATTAGTTGCTTTATGATCAAAGCTCTTTCGCTTTGGTACTAA
CCGAAAAGCTCCTCCTCTGGTGGATTTCTATAATCGCTTTCATAATAAATATTTGACTAA
CTTAGTAAATGCCTGAGTCCCAAAGAGCCGGAGGGGGATTACCCAGAGTTCCTTGCGGTC
TTGTGACGAAGCGGAACCGGATGCTCCGCCTTTTCCGCCATTAGGTGAGTTTGTGGCTGC
TGCGCTTTTTCTGCGGCTCCTACCAAAGTTGGCATATTTAGAGTTCTTTTCAAGATTCCG
TCTCAGTTTTAAGGAGTGACACGTTTGTGTGTTTTCGTTTACAGGTTGCAACCATGGGCC
GCCGACCAGCCCGCTGGTGAGTGCTGTGATTGAGCCGCTTTCGAGACGCATTTGTGGAGA
AAATGGCTGTCCGGCACCATGTGGACGCCGCTACTTTCCCGACCGAGCCGCTTGTAGAGC
TGCTTTAATGTTCGACTCTAAATGCACCGCTGTTTTTAATACGAAAAGAATTTATCATGT
CGGAGGTACGAGACGAGGTGCTGTTATTTCCCTTTTTAGCAAGGTGCGACTGCTAACATT
AGCTAACCGGGGCTAACGTTAGCTAGTTAGCTCGAGGCTAACGTAAACGTGTCAGATTCG
AGCACTAAGGTTTTGAATATGATTCGAAGAAAGGATAAATGTGACTCTTAGGCCGGGAGG
ATTTAGAGTCGGTGCGTTAATACCTCAGCTGCAAATTTGCGCCGCAGCGGTCAAAGTTAA
AATTCCTAAATTCTGTAAGGGTTTAAAGTTTGGGGCGTCGTAAACAAGAGGCAACTTTTA
CGAAAGTTGGCGTCACCTGGTTATTTTACCTGTTAGTTGACTAATTGATGAGACAAGTTT
CTGTTGATGAGAATTGTCCTGGATCATCATGGAGGTTCCGCAGGTGGAACAGCAGCGTGC
TGATCCACCTCCTGATCCCAAAAGACCTGTTGGACTGGATAGGAAATAAAACCCACATTA
ATTCATGTTTTGTCTCCACAGTTACCGTTACTGCAAGAACAAGCCCTACCCCAAGTCCCG
CTTCTGCAGGGGTGTTCCTGGTAAGCACATTCCACCCCAGCTGGTCTCTGAGCTCCGGGG
GCTCCTGCAGCTTATTAAGCCGACTGGTTCTGCTGTGGTGCGGTTCTGGTGTGCAGAGGC
TGCAGACAGTGACTCTCTGGTTGTGTATGTCCTCAGCTGGGAGGTGCTGAGTGCTTTAAG
GGACCACTGAGACAAACACTGTCTGTTACAGCAGCAGTATTTCTGCACTGCTTCTCAAGT
TATACCTCTTTTTTTTTTTTTAAGATCCTAAAATCAGGATCTTCGACTTGGGCAGGAAGA
AGGCCAAAGTGGACGAGTTTCCCCTGTGTGGTCACATGGTCTCCGATGAGTACGAGCAGC
TATCCTCCGAAGGTGAGCTGGTGTGTCCAGAAAGAAGACCCTTCAGTCTCTGATGGCTTT
AGGGAGAAGCCAACGAAGCCAGAGCTCAGAGCTGATTGTAGAAAGTTTAGTAGTTGGCCA
TTTCCTGCAGCGCTGAGCTTGGCTGGCTGACTGGATTTAGGGCTGCTGCAGAACTTTCCC
GCTGAGTTCTGGACTCTTTCTGACCAAAGTGAGTCTGAGACACCTGGTGCAACCGCGTCC
TTGTTCTCGTCACAGCTCTGGAGGCCGCTCGCATCTGTGCCAACAAGTACATGGTGAAGA
CCTGCGGCAAAGATGGCTTCCACATCCGCATGCGGCTGCACCCCTTCCACGTCATCCGCA
TCAATAAGATGTTGTCCTGCGCTGGGGCTGACCGGTGAGTCACCTGTGCTTCCTGCACCT
GTTTGAACTTGGGCACCGCTGCTGACCTGACTTGTGGACCTCAGGCTCCAGACTGGAATG
CGTGGTGCTTTTGGGAAGCCTCAGGGCACCGTGGCTCGCGTACACATTGGTCAGGTGATC
ATGTCCGTGCGCACCAAGACCCAGAACAAGGAGCACGTGGTGGAGGCCCTGCGCAGAGCC
AAGTTCAAGTTCCCTGGGCGGCAGAAGGTAAGTGAGGAAGGGTTTGTGGTCCTGAGCTGG
GCCTGAGCGAGGAGGCTGCTGCTAACCCAGACCCTCACCTGCAGATTCACATCTCCAAGA
AGTACGGCTTCACCAAGTTCAACGCCTGTGACTTTGACGACATGATGGCCGAGAAGCGTC
TGATCCCAGATGGCTGCGGGGTCAAGTACATCCCCAACAAGGGCCCGCTGTCCCGCTGGA
AGGCGCTCCACGCCAACTAGAGCTGCCAGCAGACTCCAAATAAACGTGCATTTAATTACA
GACGCCTGTCGCCCTCAGTCATTGCCACGTTCTTTTGCCTCACGAGGTTTTATCAGTCTT
GTTCCTAGTTTTAAACCCCGTTTTAGATTTGAAACCGCTCACTGGTGAGTAGTGGAGTCA
GGAGATTTGGGACATCCAGGAAACTAACTCGATCAAGAATTTGTCAGTTACAAAGCAGAG
AAATAAAGGTTCTGATCTCTAAATGAGCCTGAATAAAATGGAAATGGTTTTTGTCCTGTT
TTGAATTTGAGGTCAAAACCATGTGGCTGCTTTATCTCTTAACTGCTCCTTCAGAGCATG
TTCTTTTACTCCGCTTTATTTTATTTGTAATTAACAATATAGACACATATATACAGCAAA
GCTGGCAAAATTAATCACATTTATTCTAAAATTGGTACAGAGCATTTTAAAAGGAGCCCT
GTGGGAACCAGAGGCCCTTAGGCTGGACCATTCAGTGAGACTAAACGATCTGCGTCTGAT
GTCTGTGTAGGTTCTCAGTCATCCAGGTCATAGTTATCGTCCACAGAACCTTTTCTCGGA
TCTGCGTCTGATGTTCACATGTTTTTGCCATCGCTTGCAGTGATTGATGCTCGACAGTCT
ACTGAACGCCTCCGGCCGGGGTCGTGACCTCTCATCTGCATTTGTGGACAGAAGCCTTTC
CAGAGGTCGAAAGCTCGTCCACGAGGCGGCGCTCGTGTCCGTAAAGAATGCGGTTGGGAT
TCAAATAAAAGGAACCTTTCGTGGTGCAGTAAACCAGTTAAAAACAGCCTTTGCGTTAGG
AAATTGGAGGAGCTCGGCGGTGGTGTCGTTTTCGCTCGGTTTTATTAATTTGATTAACAG
AGTCCTGGGGTTTTTTTCCTTCCGGACTTTTTTAACTGTTACACAACATGGCCGCCTGCC
TTCGACTCACGGTCCCTCGAGCGATGCTTCCCGGAGCTTCCAGCCTCCGCAGCCGGGCCC
TGGGGCGCCCGGCGTGGCTCCGCTTTGTCCGCCATTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1155, 1821..1879, 2124..2231, 2475..2613, 2684..2846, 2924..3116
1133..1155, 1821..1879, 2124..2231, 2475..2613, 2684..2846, 2924..3079
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved