Tetraodon_nigroviridis Locus Mono:SNORD14
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORD14
Tetraodon_nigroviridis
Mono:SNORD14
Un
SNORD14
1001..1093
2093
AATTTGGTTAAAATTTCCAAATTTGTTAAATATTTTAAGAGTATTATTTTAATTATGTC
AAATTTCATATTTTTAACGTGCTGAGCAAATTTTGCCTGCATTACCTCTCCCGTCCGTGT
GGTGGCGATAGAGCGCCGGAGAGCAGCGGATGAGCCGCCATTTGGGAACAAAAGGCCGAA
GAAAAGGCGCTTCGGTCTCTCGGAGCTGCCGCGCCGAAGCCGGCGGACGGCCTCTCTCCA
CGGCAAATATCGCATTCAAAGTCGACGGTAGTTGTGAAATGGAGGTTTTACTGCAACAAC
AACTCGCAGTAGAGCGTTATCAAGTGAGTTTGTATGTTGGATGAAATGTTTGTTTGACGG
ATGGTCACAGATTGTCTTGTTGCTCCACGTTCTTACATTTTCTGTAAATTTTTTCCAAAC
GTATCATTTGTCAATATATTGGTGGAAGTTGCTTTTATGCGCTACAATCATCTTTTGACT
TCGATGACCTAAATATAAAAGCGTTTTCTGACGTTCTCGTGTAACGCCGCTGATCTTTCG
TGGTTCTCGAAACCCAAAATCATGAAACTTTGTATTTGGGTTAGAGCCGATTGCAATTAT
GACATTTTAATGTTGTTTTTTAGCTTGTTTTGTTCTTTTAGAGCAGGGGATGTCCTAACT
ATTCCCCAAAGGGCCGCGTGGCTGCAGGTTTGGGTTCCAACCAGCAGCCTGACCTCAATC
ACCTGACCTGAGTCTTCAGGCCCGATTGGTCAAACTGCACCTGACTGGTTGGGACAAAAA
CCTGCAGCGACACGGCCCTTTGGGGAACAGCTTTGATTGTGTTCAACACCTGGGTCAGCT
GAAGGCTTCTGATCGTTTTCACGTGCAGGATGAAGATGAGGATGAGGAACACCGGCGCTC
CCTAGACCGGAGCGTCCTGACGGTCTCAGTCAAGATGGACACCGTAGACCTGCTGTGGTC
AGGGGCCTTTTCATATTTTTTTCACACACAGACACACGTGCACGCTGTGATGATGTCATT
TCCTGCCATTCGTAGTTTCCACCAGAGGTCACATGACCAAAGACGGTTCAAAGCTTCCTT
GGATGTCTGAGCGAAGCGTTCAGGAGCAGGTCTGCAGAAGCCGTTAGCACTGGAAGCTAA
CTTTAGCTCTCTTTCAGGGTGAACGCTGGTGGCTGGGGATGCCGCTGACGCCGGTATGTA
CGTTTGATCTTCAAAGCTGTTTCCTGTCGCTGTGATGATGTCATTTCCTGCCATTCGTAG
TTTCCACCAGAGGTCACATGACCAAAGACGGTTCAAAGCTTCCTTGGATGTCTGAGCGAC
AGAAGCAAACGACTGTCATAATCCGACTGTTGCTGAAACGGCGTTGATGCTAACGGTTGT
CTCTCCCAGGGTGGAGGAGGCAGCGGAGACAGGGACGTGATGGAGGCTGCGCCCGCTGAC
GCCGGTACGCATGCAGTTCTGACCTCGGTCCCTGCGTTCTGTCGCTGTGATGATGTCATT
TCCTGCCATTCGTAGTTTCCACCAGAGGTCACATGACCAAAGACGGTTCAAAGCTTCCTT
GGATGTCTGAGCGAAGCGTTCAGGAGCAGGTCTGCAGAAGCCGTTAGCACTGGAAGCTAA
CTTTGGCTCTCTTTCAGGGTGAACGCTGGTGGCTGGGGATGCCCCTGACGCCGGTATGTA
CGTTTGATCTTCAAAGCTGTTTCCTGTCGCTGTGATGATGTCATTTCCTGCCATTCGTAG
TTTCCACCAGAGGTCACATGACCAAAGACGGTTCAAAGCTTCCTTGGATGTCTGAGCGAC
AGAAGCAAACGACTTATAATCCGACTGTTGCTGAAACGGCGTTGATGCTAACGGTTGTCT
CTCCCAGGGTGGAGGAGGCAGCGGAGACAGGGACGTGATTGGAGCTGCGCCCGGTGACGC
CGGTACGCATGCAGTTCTGACCTCGGTCCCTGCGTTCTGTCGCTGTGATGATGTCATTTC
CTGCCATTCGTAGTTTCCACCAGAGGTCACATGACCAAAGACGGTTCAAAGCTTCCTTGG
ATGTCTGAGCGACCGCGTGCACGTGTGCTATCAGCTGAACATTTTTCCCGCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved