Tetraodon_nigroviridis Locus Poly:SNORD14
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD14
Tetraodon_nigroviridis
Poly:SNORD14
Un
SNORD14, SNORD14
1479..1571, 1957..2049
4093
tggttaaaatttccaaatttgttaaatattttaagagtattattttaattatgtcaaat
ttcatatttttaacgtgctgagcaaattttgcctgcattacctctcccgtccgtgtggtg
gcgatagagcgccggagagcagcggatgagccgccatttgggaacaaaaggccgaagaaa
aggcgcttcggctccttcggagctgccgcgccgaagccggcggacggcctctctccacgg
caaatatcacgttcaaagtcgacggtagttgtgaaatggaggttttactgcaacaacaac
tcgcagtagagcgttatcaagtgagtttgtatgttggatgaaatgtttgtttgacggatg
gtcacagattgtcttgttgctccacgttgttacattttctgtaaattttttccaaacgta
tcatttgtcaatatattggtggaagttgcttttatgcgctacaatcatcttttgacttcg
atgacctaaatataaaagcgttttctgacgttctcgtgtaacgccgctgatctttcgtgg
ttctcgaaacccaaaatcatgaaactttgtatttgggttagagccgattgcaattatgac
attttaatgttgttttttagcttgttttgttcttttagagcagggatgtccctaacccta
actattccccaaagggccgcgtggctgcaggtttgggttccaaccagcagcctgacttca
atcacctgacctgagtcttcaggcccgattggtcaaactgcacctgactggttgggacaa
aaacctgcagcgacacggccctttggggaacagctttgattgtgttcaacacctgggtca
gctgaaggcttctgatcgttttcacgtgcaggatgaagatgaggatgaggaacaccggcg
ctccctagaccggaggtcctgacggtctcagtcaagatggacaccgtagacctgctgtgg
tcaggggccttttcatttttttcacacacagacacacgtgcacgctgtgatgatgtcatt
tcctgccattcgtagtttccaccagaggtcacatgaccaaagacggttcaaagcttcctt
ggatgtctgagcgaagcgttcaggagcaggtctgcagaagaccgttagcactggaagcta
actttggctctctttcagggtgaacgctggtggctggggatgccgctgacgccggtatgt
acgtttgatcttcaaagctgtttcctgtcgctgtgatgatgtcatttcctgccattcgta
gtttccaccagaggtcacatgaccaaagatggttcaaagcttccttggatgtctgagcga
cggaagcaaacgacttataatccgactgttgctgaaacggcgttgacgctaacggttgtc
tctcccagggtggaggaggcagcggagacagggacgtgatggaggctgcgcctgtgacgc
cggtacgcatgcagttctgacctcggtccctgcgttctgtcgctgtgatgatgtcatttc
ctgccattcgtagtttccaccagaggtcacatgaccaaagacggttcaaagcttccttgg
atgtctgagcgaagcgttcaggagcaggtctgcagaagccgttagcactggaagctaact
ttggctctctttcagggtgaacgctggtggctggggatgccgctgacgccggtatgtacg
tttgatcttcaaagctgtttcctgtcgctgtgatgatgtcatttcctgccattcgtagtt
tccaccagaggtcacatgaccaaagatggttcaaagcttccttggatgtctgagcgacgg
aagcaaacgacttataatccgactgttgctgaaacggcgttgacgctaacggttgtctct
cccagggtggaggaggcagcggagacagggacgtgatgtgagtgctgcgctgtgacgccg
gtacgcatgcagttctgacctcggtccctgcgttctgtcgctgtgatgatgtcatttcct
gccattcgtagtttccaccagaggtcacatgaccaaagacggttcaaagcttccttggat
gtctgagcgaccgcgtgcacgtgtgctatcatctgaacattttttcccgcttatgctaac
tttggttcctcccacaggaccactggtcggctgtgaagcagcacccttgacctttgaccc
cagtgtaacctgacagactgcgagccttttggaaggtgactggatacatctctggaacaa
ttatgtgcctgagcttcaaagctgcaagctagtttgcttacatgaaagtagcagcaggag
cctggtgtggtgttcgggctcctggggcgttgacctttgaccctttcccagtgcttgact
ggttggctgtgtgacctgttttaggacaaatgtgtcatctgcttctgtgaacaataaaaa
ctgaaaaatgtttgcgttctgggttgaacctgctcttgtaaaccagatgaaactggttca
ggcctgcgtgtggctccctccgccagtacagtcctacgctgtcgcgccagtgtgacgtca
ctgaatggcgactcgccgggaggatttttggccccgctgccgtaccgaggctcggcggtc
ttcgggctttttcggtgcgagcggagattcccgaagcctcggcggcggctgctgctcagg
taggacgcgaatgactccccagagggcgggagcgtcgccttagaaaccagctgccccgaa
cggcagctagctgtggctaaagctaactcggaggagctgtttagaccaccccggagacca
ctttagtcggtccggaccgggaccgggtccaccgcgtgacgttgtgtctgtgttccagga
aggtctgaaaaggagccgacgagagcgggaagcagcgtcccgccacctggcccgctaacg
ccgcggccacgccccctaatgaaccgcgtcgcgttccaggatgctgcacgagcggctcca
ccgcgggcacgaggccatacacgcggagatcatcctggtccggtggaagcagagacgcgg
cgcctacaaagcaggttcctcccccaggaagtcgctgtgaagggaaatgagaacatccgg
agtattttcaaaagaaaagctcccggtttttaccggccgacgcgagggtggtctcccgag
ccagaccataacaaggactcaggaccaggttctggtcctcagctggtccagatgtgggcg
gtgcccgcttcctgtgcgtgtgggggctcttctccgtcatcccaggtggtccaggcacag
ctggagactcgccgggccggttctgcttgtaaccgtggcgactgttcttctgcaggatgg
tggaccggttgagggcgggggggtcctgggctgcctggccaccacctgctcggtccgggg
agggctccatggacgtgggcgtggtcctgctctccaccggttgcctggcaatccattgtc
ctcggctgtgtccagggggacctcggtcctgggcctggaccgttagctgccggctaatgt
tagcgcagcgaccggaggaacctgcctgacggttggtgccagaaaagaggcggagagcca
gagggggtgtgtctgcaggtctggatttattcaggaagacgcccgtccgtccgtccgtcc
gtccatccatccaaccgtccatccatcagactccaggctggaggagcccccagaacctct
ggacctgggggctccgtcagctcctccccccctccacctccagccccttctctttctact
cctccctactctcctcctcctccaggccctgctcctgctcccccnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved