Tetraodon_nigroviridis Locus Poly:SNORD89
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD89
Tetraodon_nigroviridis
Poly:SNORD89
Un
SNORD89, SNORD89
1001..1109, 1754..1872
3109
TATAAGTTGAACATAACCCTAACCCTGACCCTGACCCTGAACATGAACATGTTACACAG
TAAAAGAAACCAGACGTCGCTTCGGTGAGTAACCGCCGCTAACACAGTAGCTTCGTCAGC
GAATGATGCTAAATTTGGCTTTTGTGTCCTGATGGATTCTTTACGGTAAGTGAAAATAGC
TAAATCCACGATCTGAAAGCGTCCATGTGTAAAATTATAGTAATGTGGCTGGATGATTCT
GTTGTGTTTAAAGGGCTAAAACCTTAATGAGTTTTATTTTAGCAAACGTTTTTCTCCCGC
TTGTCCGTCACTTTTTACGGTCCCCTGGAAACATGAGGCGGGCCCGGCCTTTCTGCGCTT
CGGTGCGGTCACCGCTTTGTCTCCAAAGGGAAAAGTTTCGAATAAATGATTCAGTTTTCC
TCTGGTACAAACATTGGTTTACAGAATAAACAGAATTTCTTTTAGGGGTTGTTTTTTTTT
TTTCCAACAGAATAATTTTTCTTGCGGAATTTATAAAGTGTGCATCTTGTCGAGGCCTTG
TGAGAGTCCACGGGACTTCTGAAGTCCAGAAGTCTGTGTAGATGTTCCTCATTTAGATCA
TAGTTATCCAAGGTTAGATATCAGTGTTTAACTGGACTGTTTTAGGTTTCCTTGGAGATG
TTTGTCTTTTTCTCCAGAAGGTTTCCTTAGTTCTAAGCACCCAAACTGAAACTAGGCCAA
CGACCCTCAGCTGACCTTCCCCCCAGATCATTACCACGTTAATGGTCCACAAGGGCTGTA
TTTGCAAGCTCTGCCATCAGCAAGTTTAGAACTGAAGAAGCCTTCTGGAGAAAGAGACAA
ACAGCTTTGAAGGAACCTAAACAAGTGCAGCTGAACACAGGAATCTAACTTGGATATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGAGTGCTCCTGTCTCAAGCC
AGATGAGCTAGTCCAGCTACCGGTTTAGTAGCTTGTTGTCTACCTGGATGTGATGTAACA
AAAGGCCGAATGAAGCTCCGCCCACAGCAGACTGTTCACAGTGGGTGGAGCTGTGACAAA
AATCGGACTGAAGCGTGTTCTGATCCGGGTCCTAGGCTGCAGACGCCACCTCTTTACGTT
TAACCTAATGGTAAACATGTAGTTTCTGGTTTGCAGATTGACGCAGGAAGTGTGTGTTGG
TCACACTCCTCCCTCTCCGACGAGCTCTGATCTGTGCTGAAGATGAAGCTTGAATGCCAG
ACCTTCGTCTCTGCCCTGAGCGACGTCACAGGTAACCTTCGATGTCCTCCTGGCATCAGA
ATTCAAGCTTGCTCTGGTCATCTTCTAGCTCAGCTCACATTTTCTGTGTGAGAACTTGAC
CCCCCAGAAAAACAAATAAAAGTATAAAAGATCATAAAAGAAAACTAGAATAGAAGTAAA
TGACACCTCATCAAAAGAGAAATGAATAAATGATACTGTACTACCTTAATAACCTGCAAT
TAGAAAATTGCAAATTTTAGCAGCAAAGGGCATATAAACATCAAAGACTTTGGGCTAACC
CTATATACTTGCATGAATATACTGTGCTGTACAAGAACTGCATGGCCATATTGCACATGA
AATACACTGATAAAGGGTTAGGGTGATATGATAATGATGCTATTCCCTCTCAAAGAGATG
TAATCTTGAAGTCCCTCACTTCAGTAGAACTGAGGGATAACCGGGACTCCTTTATTTTGG
CGGTGGCTTTGATGCCTGCTGGGAGATGATGTGAACAAAAGGCCGAATTAAAGCGCTGCC
AGCAGCCAGTGTGGGCTTGCTGGGGGCGCCATGATAAAACCGGACTGAAGCGTTCATCTG
ATCCCACGGCAGAAGCTTCACACACCAGCTGAAAGGAGAGCTGGTGGATCCCTGAGCAGA
TCAGCCAAAGAAGCCATGAAAGCATCACTCTGGCGTTGGGAAACAGAATTGACCATATAA
GAGACAAGTTGTTACACTTCAGCTTTTCCAATGTTGCATGTCTGATGTTAAGTGATCTTA
GATTTATTAGTCTTTCTACAGAGTATGAGGAACTAACTTGGTGCTCAAATTTATGCAGCA
AAGCTCCATATCCTAACTTTTGTGTCTTTAGATTTTGTTTCAATCTTTTTAAAAACGTTT
GCTTTCTTCTTCTCCGCCTAGCGTGTTTTTGTTTTAGTGTCGCGACCTTTCACCCGGGGT
TCCGCCTGCTTGGGCCCGCCCTACTCCATCTCTGATTGGCCTCTGCCAATTTACGAATTT
CGATTCGCCTGACGTACAGCAGATCAGCCAATCAGAACCCAGGGACACTGGATTATGGAG
CTTGCTGCTCGGGACCGAGTTTCCCGTGCGGACTCATCTGGGTCTGAACAGCCGGACCGG
ACCGGGACGTGTGGAGTGTTCCGACCGGCAGGATGGACACAATCACGGCTTTTACGGTAA
TGTCCCGAACCGTTTTATCTTCCTCAGAGGACACTTCCCGCTGCGCTGTTAGCATTAGCG
GCTAACCGAGCTAGCGTCCGTACCAGCGCAGAGCCCGGGCTGCTGCCGGACCGGGCCGGA
CCGGTCGGAGGATTTTAACACCGGTTCCCGTTAGATCGGGCCAGGGTTTGTTCAGTGGCC
GGAGCATCTTTGCTCTCCAGTCGGCTGTGCTGGAGGCCCTCGGTTCTGAAGCGTTTGGAT
CAGTCGCTTCTCCGGACCTGTAGATACCATGACTTTGAGTTGCGCAGAAGATAGCCGAGA
AGGAAGACTGAAAGGAGTCAGAAGGTCCATCGCTATATGATTACCTCTAGAAGAAAGTCA
TTTAAAACTCATCCTGTGCTCAAAGATGCTTTTTGGGCCTGGTTCTGTTGGGTTTCCGCC
CTCTGGAGATGGTTTCATGGGTCCTACAGAGCACGTCTGGTTTGTTCTAGTGAAAGTGTC
CCGATGCTGCACCTGTTCGGAACCTTGTGGTTTGTGTTCTGGAGGTCCAGCTCTTCTGAA
TTTGTGGTTTTAAAAAGCTCCTCCTTGGTTCCTTGAGGCGACGGGTCGGGTAAAAAGCTG
CTTCCAGATGTAAATATACTACCACCACTGGACCTGAACGCTCATCTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved